FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626925_at:

>probe:Drosophila_2:1626925_at:306:327; Interrogation_Position=4979; Antisense; GCGATCCCGAAGTAGAAGCGAGCAG
>probe:Drosophila_2:1626925_at:415:379; Interrogation_Position=5009; Antisense; GAAGCGAAAATCATACATAGCATAT
>probe:Drosophila_2:1626925_at:230:317; Interrogation_Position=5068; Antisense; GCCGAAAAAACCGTCTAGTCACAAG
>probe:Drosophila_2:1626925_at:18:133; Interrogation_Position=5077; Antisense; ACCGTCTAGTCACAAGGTCTTCAGA
>probe:Drosophila_2:1626925_at:377:79; Interrogation_Position=5091; Antisense; AGGTCTTCAGACTAGTTATTGTTTT
>probe:Drosophila_2:1626925_at:45:311; Interrogation_Position=5135; Antisense; CCACACATCTAAATGTACGTTTGTA
>probe:Drosophila_2:1626925_at:364:135; Interrogation_Position=5179; Antisense; ACGACACACATATTTATACGACGAT
>probe:Drosophila_2:1626925_at:462:245; Interrogation_Position=5243; Antisense; AATTTTCTGCTTTCCATACACGATG
>probe:Drosophila_2:1626925_at:342:695; Interrogation_Position=5253; Antisense; TTTCCATACACGATGCGCAGCAGCA
>probe:Drosophila_2:1626925_at:266:33; Interrogation_Position=5352; Antisense; ATCAATGTGTTTTGCTAGTACGTAG
>probe:Drosophila_2:1626925_at:96:475; Interrogation_Position=5376; Antisense; GTTAAGTGCGTGTGATTGTACGTAA
>probe:Drosophila_2:1626925_at:224:7; Interrogation_Position=5439; Antisense; ATTGAACGCGAATTGTGAGCAGAGA
>probe:Drosophila_2:1626925_at:306:167; Interrogation_Position=5471; Antisense; AAATGCGCCCGATGAGAGGTGTTTT
>probe:Drosophila_2:1626925_at:302:433; Interrogation_Position=5486; Antisense; GAGGTGTTTTAGCTGTATGTATGTA

Paste this into a BLAST search page for me
GCGATCCCGAAGTAGAAGCGAGCAGGAAGCGAAAATCATACATAGCATATGCCGAAAAAACCGTCTAGTCACAAGACCGTCTAGTCACAAGGTCTTCAGAAGGTCTTCAGACTAGTTATTGTTTTCCACACATCTAAATGTACGTTTGTAACGACACACATATTTATACGACGATAATTTTCTGCTTTCCATACACGATGTTTCCATACACGATGCGCAGCAGCAATCAATGTGTTTTGCTAGTACGTAGGTTAAGTGCGTGTGATTGTACGTAAATTGAACGCGAATTGTGAGCAGAGAAAATGCGCCCGATGAGAGGTGTTTTGAGGTGTTTTAGCTGTATGTATGTA

Full Affymetrix probeset data:

Annotations for 1626925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720