FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626927_at:

>probe:Drosophila_2:1626927_at:64:195; Interrogation_Position=161; Antisense; AACTGAGGAAGGACTTGCTGGCACT
>probe:Drosophila_2:1626927_at:27:151; Interrogation_Position=173; Antisense; ACTTGCTGGCACTGCAGAGTCCCAA
>probe:Drosophila_2:1626927_at:316:55; Interrogation_Position=212; Antisense; ATGAAGCCAAAGTGCCAGCGACGAC
>probe:Drosophila_2:1626927_at:32:335; Interrogation_Position=22; Antisense; GCTGATAGACTCAAGGCTGCCGATA
>probe:Drosophila_2:1626927_at:582:505; Interrogation_Position=223; Antisense; GTGCCAGCGACGACGAAACCCAAAA
>probe:Drosophila_2:1626927_at:272:227; Interrogation_Position=34; Antisense; AAGGCTGCCGATATGCGGCAATTGA
>probe:Drosophila_2:1626927_at:129:459; Interrogation_Position=340; Antisense; GATATATCCGAGCAAAATCCCATAC
>probe:Drosophila_2:1626927_at:695:235; Interrogation_Position=355; Antisense; AATCCCATACGCCAGGCTCAAGTTA
>probe:Drosophila_2:1626927_at:602:215; Interrogation_Position=374; Antisense; AAGTTACACCTGAGCTGTTTGGAGT
>probe:Drosophila_2:1626927_at:37:353; Interrogation_Position=403; Antisense; GCAGCACTTGAACTTGCCGGAGAGT
>probe:Drosophila_2:1626927_at:640:587; Interrogation_Position=411; Antisense; TGAACTTGCCGGAGAGTCGGGTTAA
>probe:Drosophila_2:1626927_at:348:289; Interrogation_Position=49; Antisense; CGGCAATTGAAGAACGCGTACGAAA
>probe:Drosophila_2:1626927_at:438:481; Interrogation_Position=66; Antisense; GTACGAAAACCGATTGACTCACATA
>probe:Drosophila_2:1626927_at:240:405; Interrogation_Position=81; Antisense; GACTCACATACAGAAATCAGCCAAA

Paste this into a BLAST search page for me
AACTGAGGAAGGACTTGCTGGCACTACTTGCTGGCACTGCAGAGTCCCAAATGAAGCCAAAGTGCCAGCGACGACGCTGATAGACTCAAGGCTGCCGATAGTGCCAGCGACGACGAAACCCAAAAAAGGCTGCCGATATGCGGCAATTGAGATATATCCGAGCAAAATCCCATACAATCCCATACGCCAGGCTCAAGTTAAAGTTACACCTGAGCTGTTTGGAGTGCAGCACTTGAACTTGCCGGAGAGTTGAACTTGCCGGAGAGTCGGGTTAACGGCAATTGAAGAACGCGTACGAAAGTACGAAAACCGATTGACTCACATAGACTCACATACAGAAATCAGCCAAA

Full Affymetrix probeset data:

Annotations for 1626927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720