FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626928_at:

>probe:Drosophila_2:1626928_at:294:693; Interrogation_Position=1001; Antisense; TTTACCTTTTTCAGTTCGACGCGAG
>probe:Drosophila_2:1626928_at:702:81; Interrogation_Position=1056; Antisense; AGGGCGCAATCAGTACACGTTCGTT
>probe:Drosophila_2:1626928_at:72:447; Interrogation_Position=1098; Antisense; GATGCTGGACGATCACACGAACGAT
>probe:Drosophila_2:1626928_at:369:385; Interrogation_Position=592; Antisense; GAACATTTACGCTTTCATGGTGTAT
>probe:Drosophila_2:1626928_at:312:689; Interrogation_Position=647; Antisense; TATTTGATTCTCCAGTACTAGCCGA
>probe:Drosophila_2:1626928_at:497:489; Interrogation_Position=661; Antisense; GTACTAGCCGAGATGCCAAGCACAA
>probe:Drosophila_2:1626928_at:669:369; Interrogation_Position=690; Antisense; GAATGGGTCTGCTCTAAGCTGGGTA
>probe:Drosophila_2:1626928_at:455:591; Interrogation_Position=709; Antisense; TGGGTAGACCTGCAGATACGCCCTA
>probe:Drosophila_2:1626928_at:529:671; Interrogation_Position=725; Antisense; TACGCCCTATGTTCATGAGTCGACT
>probe:Drosophila_2:1626928_at:13:103; Interrogation_Position=759; Antisense; AGAGCACAATCGCACAGAGGCCCTT
>probe:Drosophila_2:1626928_at:718:235; Interrogation_Position=813; Antisense; AATCGAAAGCCTCTATATAGCCCGC
>probe:Drosophila_2:1626928_at:392:389; Interrogation_Position=904; Antisense; GAAAAAGATTGGTCGCCCACAGTGT
>probe:Drosophila_2:1626928_at:140:505; Interrogation_Position=927; Antisense; GTGCGCCAACTTCATGATTTACCTA
>probe:Drosophila_2:1626928_at:561:481; Interrogation_Position=959; Antisense; GTATTTCCCAAGTTATGGCGCCGAT

Paste this into a BLAST search page for me
TTTACCTTTTTCAGTTCGACGCGAGAGGGCGCAATCAGTACACGTTCGTTGATGCTGGACGATCACACGAACGATGAACATTTACGCTTTCATGGTGTATTATTTGATTCTCCAGTACTAGCCGAGTACTAGCCGAGATGCCAAGCACAAGAATGGGTCTGCTCTAAGCTGGGTATGGGTAGACCTGCAGATACGCCCTATACGCCCTATGTTCATGAGTCGACTAGAGCACAATCGCACAGAGGCCCTTAATCGAAAGCCTCTATATAGCCCGCGAAAAAGATTGGTCGCCCACAGTGTGTGCGCCAACTTCATGATTTACCTAGTATTTCCCAAGTTATGGCGCCGAT

Full Affymetrix probeset data:

Annotations for 1626928_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720