FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626929_at:

>probe:Drosophila_2:1626929_at:85:487; Interrogation_Position=1075; Antisense; GTAGCTTGGCCCTCAAGGCGCAGTA
>probe:Drosophila_2:1626929_at:346:483; Interrogation_Position=1097; Antisense; GTATGTGATGGACAACCACCTGGGT
>probe:Drosophila_2:1626929_at:234:569; Interrogation_Position=1122; Antisense; GGCATAATGATCTGGTCGCTGGAAT
>probe:Drosophila_2:1626929_at:529:201; Interrogation_Position=1203; Antisense; AACCGTGTGCTCTTCGGTGGCAATA
>probe:Drosophila_2:1626929_at:205:521; Interrogation_Position=1219; Antisense; GTGGCAATACACCATCTGGCTTGAC
>probe:Drosophila_2:1626929_at:275:79; Interrogation_Position=1274; Antisense; AGGATTCAGTTGTCCAGCTGACGCG
>probe:Drosophila_2:1626929_at:348:135; Interrogation_Position=1294; Antisense; ACGCGCCCGCTGGATATATTCGTGA
>probe:Drosophila_2:1626929_at:559:687; Interrogation_Position=1308; Antisense; TATATTCGTGATCCGGACAACTGCT
>probe:Drosophila_2:1626929_at:211:559; Interrogation_Position=1322; Antisense; GGACAACTGCTCCAAGTTCTACTAC
>probe:Drosophila_2:1626929_at:424:93; Interrogation_Position=1336; Antisense; AGTTCTACTACTGCAGTGGCGGCAA
>probe:Drosophila_2:1626929_at:638:211; Interrogation_Position=1359; Antisense; AAGACCCACAACTTTGATTGTCCCA
>probe:Drosophila_2:1626929_at:9:507; Interrogation_Position=1377; Antisense; TGTCCCAGTGGACTCAACTTTGACC
>probe:Drosophila_2:1626929_at:491:247; Interrogation_Position=920; Antisense; AATTGCAGGAAACTACTCCCGCGAG
>probe:Drosophila_2:1626929_at:556:571; Interrogation_Position=948; Antisense; GGCGTCCTGGGTTACAACGAACTGT

Paste this into a BLAST search page for me
GTAGCTTGGCCCTCAAGGCGCAGTAGTATGTGATGGACAACCACCTGGGTGGCATAATGATCTGGTCGCTGGAATAACCGTGTGCTCTTCGGTGGCAATAGTGGCAATACACCATCTGGCTTGACAGGATTCAGTTGTCCAGCTGACGCGACGCGCCCGCTGGATATATTCGTGATATATTCGTGATCCGGACAACTGCTGGACAACTGCTCCAAGTTCTACTACAGTTCTACTACTGCAGTGGCGGCAAAAGACCCACAACTTTGATTGTCCCATGTCCCAGTGGACTCAACTTTGACCAATTGCAGGAAACTACTCCCGCGAGGGCGTCCTGGGTTACAACGAACTGT

Full Affymetrix probeset data:

Annotations for 1626929_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720