FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626930_at:

>probe:Drosophila_2:1626930_at:115:643; Interrogation_Position=3764; Antisense; TCTTTTGGACCGTATTTGCTCATTC
>probe:Drosophila_2:1626930_at:692:83; Interrogation_Position=3818; Antisense; AGTGCTGAACTGTTAGGACCATTTT
>probe:Drosophila_2:1626930_at:44:657; Interrogation_Position=3862; Antisense; TAATGTGAAAGCAGGCGCAAGCCGT
>probe:Drosophila_2:1626930_at:673:247; Interrogation_Position=3879; Antisense; CAAGCCGTACGTTCCACTAGAGAAA
>probe:Drosophila_2:1626930_at:213:361; Interrogation_Position=4031; Antisense; GCAAGTGTATTATCGGGCATCCTAT
>probe:Drosophila_2:1626930_at:704:41; Interrogation_Position=4042; Antisense; ATCGGGCATCCTATATCATTTTATT
>probe:Drosophila_2:1626930_at:486:451; Interrogation_Position=4079; Antisense; GATCTTTCGATTTTTTCGACTCTCC
>probe:Drosophila_2:1626930_at:4:401; Interrogation_Position=4096; Antisense; GACTCTCCCGTATATGCGATTAGTG
>probe:Drosophila_2:1626930_at:220:393; Interrogation_Position=4167; Antisense; GAAAGCCGCGATGCATATTTATCAA
>probe:Drosophila_2:1626930_at:68:481; Interrogation_Position=4218; Antisense; GTTTGTTCTGGTACAGGATCCTCTA
>probe:Drosophila_2:1626930_at:104:545; Interrogation_Position=4233; Antisense; GGATCCTCTACTTTCGAGTCTTCGA
>probe:Drosophila_2:1626930_at:389:431; Interrogation_Position=4248; Antisense; GAGTCTTCGAGCTGTTTGAACTGAA
>probe:Drosophila_2:1626930_at:227:15; Interrogation_Position=4278; Antisense; ATTACCAAGTATGTTGTGACGGCCG
>probe:Drosophila_2:1626930_at:561:511; Interrogation_Position=4293; Antisense; GTGACGGCCGAAAATATCTGAAAAT

Paste this into a BLAST search page for me
TCTTTTGGACCGTATTTGCTCATTCAGTGCTGAACTGTTAGGACCATTTTTAATGTGAAAGCAGGCGCAAGCCGTCAAGCCGTACGTTCCACTAGAGAAAGCAAGTGTATTATCGGGCATCCTATATCGGGCATCCTATATCATTTTATTGATCTTTCGATTTTTTCGACTCTCCGACTCTCCCGTATATGCGATTAGTGGAAAGCCGCGATGCATATTTATCAAGTTTGTTCTGGTACAGGATCCTCTAGGATCCTCTACTTTCGAGTCTTCGAGAGTCTTCGAGCTGTTTGAACTGAAATTACCAAGTATGTTGTGACGGCCGGTGACGGCCGAAAATATCTGAAAAT

Full Affymetrix probeset data:

Annotations for 1626930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720