Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626931_a_at:

>probe:Drosophila_2:1626931_a_at:585:219; Interrogation_Position=131; Antisense; AAGTCGCTCCGCAAGAAGCGCAAGT
>probe:Drosophila_2:1626931_a_at:552:355; Interrogation_Position=150; Antisense; GCAAGTTCGAGTTGGGACGCCCCGC
>probe:Drosophila_2:1626931_a_at:594:591; Interrogation_Position=223; Antisense; TGGTGGAAACACCAAGCTCCGTGCT
>probe:Drosophila_2:1626931_a_at:203:505; Interrogation_Position=243; Antisense; GTGCTCTGCGCCTGGAAACCGGAAA
>probe:Drosophila_2:1626931_a_at:456:433; Interrogation_Position=288; Antisense; GAGTGGCGCGCAAGACCCGTATCGC
>probe:Drosophila_2:1626931_a_at:148:305; Interrogation_Position=304; Antisense; CCGTATCGCCGATGTTGTGTACAAC
>probe:Drosophila_2:1626931_a_at:198:597; Interrogation_Position=319; Antisense; TGTGTACAACGCCTCCAACAACGAG
>probe:Drosophila_2:1626931_a_at:292:119; Interrogation_Position=342; Antisense; AGCTGGTGCGAACCAAGACCTTGGT
>probe:Drosophila_2:1626931_a_at:607:517; Interrogation_Position=409; Antisense; GTGGTACGAGGCTCACTACGTGCTG
>probe:Drosophila_2:1626931_a_at:459:591; Interrogation_Position=438; Antisense; TGGGACGCAAGCGTAACCCCAAGCA
>probe:Drosophila_2:1626931_a_at:83:91; Interrogation_Position=543; Antisense; AGTACGGCAAGGTCGAGCAGGCCCT
>probe:Drosophila_2:1626931_a_at:181:421; Interrogation_Position=557; Antisense; GAGCAGGCCCTCGAGGATCAGTTCA
>probe:Drosophila_2:1626931_a_at:666:539; Interrogation_Position=80; Antisense; GGTATTAGCCGCGATAGTGCACACA
>probe:Drosophila_2:1626931_a_at:390:455; Interrogation_Position=92; Antisense; GATAGTGCACACAAACGCCGGGCCA

Paste this into a BLAST search page for me
AAGTCGCTCCGCAAGAAGCGCAAGTGCAAGTTCGAGTTGGGACGCCCCGCTGGTGGAAACACCAAGCTCCGTGCTGTGCTCTGCGCCTGGAAACCGGAAAGAGTGGCGCGCAAGACCCGTATCGCCCGTATCGCCGATGTTGTGTACAACTGTGTACAACGCCTCCAACAACGAGAGCTGGTGCGAACCAAGACCTTGGTGTGGTACGAGGCTCACTACGTGCTGTGGGACGCAAGCGTAACCCCAAGCAAGTACGGCAAGGTCGAGCAGGCCCTGAGCAGGCCCTCGAGGATCAGTTCAGGTATTAGCCGCGATAGTGCACACAGATAGTGCACACAAACGCCGGGCCA

Full Affymetrix probeset data:

Annotations for 1626931_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime