FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626939_at:

>probe:Drosophila_2:1626939_at:94:127; Interrogation_Position=141; Antisense; AGCCAAGCGAGTACCCGTCCTGTTT
>probe:Drosophila_2:1626939_at:126:201; Interrogation_Position=172; Antisense; AACCGTGGACTCTATCTGCGCCTGG
>probe:Drosophila_2:1626939_at:546:577; Interrogation_Position=195; Antisense; GGCCCAACCACTGGCAGATCAGATG
>probe:Drosophila_2:1626939_at:31:533; Interrogation_Position=222; Antisense; GGTGATGACACTGCAGCCAAGCGGA
>probe:Drosophila_2:1626939_at:453:331; Interrogation_Position=242; Antisense; GCGGACAGAACTACAACATCAGCTT
>probe:Drosophila_2:1626939_at:724:189; Interrogation_Position=256; Antisense; AACATCAGCTTCTGCGATCTGGAGC
>probe:Drosophila_2:1626939_at:376:333; Interrogation_Position=281; Antisense; GCTGGAGCACCAATCGGGCGAATGT
>probe:Drosophila_2:1626939_at:705:229; Interrogation_Position=301; Antisense; AATGTGGTCAGCCTGGAGGACACCT
>probe:Drosophila_2:1626939_at:370:549; Interrogation_Position=315; Antisense; GGAGGACACCTTTAGCATCATGCAG
>probe:Drosophila_2:1626939_at:589:123; Interrogation_Position=341; Antisense; AGCGCAATATGTCGCCGGAGTCTAT
>probe:Drosophila_2:1626939_at:74:551; Interrogation_Position=357; Antisense; GGAGTCTATGAACTACCAGCCACGC
>probe:Drosophila_2:1626939_at:422:563; Interrogation_Position=386; Antisense; GGAAGAACAACGTCAGCTACAGCCT
>probe:Drosophila_2:1626939_at:192:549; Interrogation_Position=63; Antisense; GGAGGCGGTGTCTACGCTCAATCAT
>probe:Drosophila_2:1626939_at:82:673; Interrogation_Position=97; Antisense; TACCGACAGATTCCAGGTGCCGGAA

Paste this into a BLAST search page for me
AGCCAAGCGAGTACCCGTCCTGTTTAACCGTGGACTCTATCTGCGCCTGGGGCCCAACCACTGGCAGATCAGATGGGTGATGACACTGCAGCCAAGCGGAGCGGACAGAACTACAACATCAGCTTAACATCAGCTTCTGCGATCTGGAGCGCTGGAGCACCAATCGGGCGAATGTAATGTGGTCAGCCTGGAGGACACCTGGAGGACACCTTTAGCATCATGCAGAGCGCAATATGTCGCCGGAGTCTATGGAGTCTATGAACTACCAGCCACGCGGAAGAACAACGTCAGCTACAGCCTGGAGGCGGTGTCTACGCTCAATCATTACCGACAGATTCCAGGTGCCGGAA

Full Affymetrix probeset data:

Annotations for 1626939_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720