FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626940_at:

>probe:Drosophila_2:1626940_at:622:497; Interrogation_Position=3396; Antisense; GTGCTTAACTCCAGCTGAGTTTCAG
>probe:Drosophila_2:1626940_at:720:97; Interrogation_Position=3437; Antisense; AGAGGTTCTTTGGTGTTTCTGGCCG
>probe:Drosophila_2:1626940_at:162:583; Interrogation_Position=3481; Antisense; TGGCGATTCCATATCGTGTTCCGAT
>probe:Drosophila_2:1626940_at:622:23; Interrogation_Position=3515; Antisense; ATATCCGTCTTCCATCCGAAGAGAG
>probe:Drosophila_2:1626940_at:176:383; Interrogation_Position=3539; Antisense; GAACGTCGTGTAGCATTTGCTCCAA
>probe:Drosophila_2:1626940_at:716:721; Interrogation_Position=3555; Antisense; TTGCTCCAAAATGTCTATGCTGTTT
>probe:Drosophila_2:1626940_at:500:697; Interrogation_Position=3608; Antisense; TTTCTTGTGGCTGCGCTCAACAGAA
>probe:Drosophila_2:1626940_at:165:123; Interrogation_Position=3673; Antisense; AGCGTTCATGCTACATTTGTTTCAG
>probe:Drosophila_2:1626940_at:93:93; Interrogation_Position=3700; Antisense; AGTTCAAGTGTCATTCCACGGACCG
>probe:Drosophila_2:1626940_at:265:719; Interrogation_Position=3713; Antisense; TTCCACGGACCGAGATCAGTTTATA
>probe:Drosophila_2:1626940_at:71:713; Interrogation_Position=3763; Antisense; TTCACCCAGTGCATGTGCTGTGTAT
>probe:Drosophila_2:1626940_at:531:329; Interrogation_Position=3788; Antisense; GCGTGTGTTCGCAAATCTATTATTT
>probe:Drosophila_2:1626940_at:1:199; Interrogation_Position=3871; Antisense; AACGCAGTTGTCTTGCATCATTAGA
>probe:Drosophila_2:1626940_at:97:159; Interrogation_Position=3968; Antisense; ACAACTATCGCATCCTACGTGTTAA

Paste this into a BLAST search page for me
GTGCTTAACTCCAGCTGAGTTTCAGAGAGGTTCTTTGGTGTTTCTGGCCGTGGCGATTCCATATCGTGTTCCGATATATCCGTCTTCCATCCGAAGAGAGGAACGTCGTGTAGCATTTGCTCCAATTGCTCCAAAATGTCTATGCTGTTTTTTCTTGTGGCTGCGCTCAACAGAAAGCGTTCATGCTACATTTGTTTCAGAGTTCAAGTGTCATTCCACGGACCGTTCCACGGACCGAGATCAGTTTATATTCACCCAGTGCATGTGCTGTGTATGCGTGTGTTCGCAAATCTATTATTTAACGCAGTTGTCTTGCATCATTAGAACAACTATCGCATCCTACGTGTTAA

Full Affymetrix probeset data:

Annotations for 1626940_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720