Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626941_at:

>probe:Drosophila_2:1626941_at:125:593; Interrogation_Position=1010; Antisense; TGGGAAGACCATCTGCCACTGGTAG
>probe:Drosophila_2:1626941_at:674:675; Interrogation_Position=1032; Antisense; TAGCTACTCAGACTCCATCCAAATG
>probe:Drosophila_2:1626941_at:30:503; Interrogation_Position=1068; Antisense; GTCGCGAGTGACCTTCAGTGAGAAT
>probe:Drosophila_2:1626941_at:436:203; Interrogation_Position=1132; Antisense; AAGCCGTCGCAATCCACAATTGACT
>probe:Drosophila_2:1626941_at:236:39; Interrogation_Position=1163; Antisense; ATCTAATTGAGCAGCGTCGTCGCGA
>probe:Drosophila_2:1626941_at:31:81; Interrogation_Position=1192; Antisense; AGGGAACGCATTCGACACCGATTTT
>probe:Drosophila_2:1626941_at:545:171; Interrogation_Position=1226; Antisense; AAAGTACCCATCTGCGACATGATAC
>probe:Drosophila_2:1626941_at:726:533; Interrogation_Position=1255; Antisense; GGTGCTCCTTATACGATCACAGTTC
>probe:Drosophila_2:1626941_at:509:305; Interrogation_Position=1288; Antisense; CCATCCGATGAAACTCTGTCCGAGA
>probe:Drosophila_2:1626941_at:294:417; Interrogation_Position=1331; Antisense; GAGCTCAACAGGATCCATCGGGCAG
>probe:Drosophila_2:1626941_at:70:347; Interrogation_Position=801; Antisense; GCACCAGGAGCATCCGGAACTTGTT
>probe:Drosophila_2:1626941_at:661:55; Interrogation_Position=857; Antisense; ATGAAATTCCATACGCTCAGCCAAA
>probe:Drosophila_2:1626941_at:461:51; Interrogation_Position=883; Antisense; ATGCGTCAAAATCCTCCAGCAGCTT
>probe:Drosophila_2:1626941_at:723:263; Interrogation_Position=958; Antisense; GCAATGTCAACTCTTAGTACCCGTT

Paste this into a BLAST search page for me
TGGGAAGACCATCTGCCACTGGTAGTAGCTACTCAGACTCCATCCAAATGGTCGCGAGTGACCTTCAGTGAGAATAAGCCGTCGCAATCCACAATTGACTATCTAATTGAGCAGCGTCGTCGCGAAGGGAACGCATTCGACACCGATTTTAAAGTACCCATCTGCGACATGATACGGTGCTCCTTATACGATCACAGTTCCCATCCGATGAAACTCTGTCCGAGAGAGCTCAACAGGATCCATCGGGCAGGCACCAGGAGCATCCGGAACTTGTTATGAAATTCCATACGCTCAGCCAAAATGCGTCAAAATCCTCCAGCAGCTTGCAATGTCAACTCTTAGTACCCGTT

Full Affymetrix probeset data:

Annotations for 1626941_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime