FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626942_at:

>probe:Drosophila_2:1626942_at:362:607; Interrogation_Position=429; Antisense; TGAGACGCAAATGTCCGCACTGACG
>probe:Drosophila_2:1626942_at:658:459; Interrogation_Position=491; Antisense; GATTTGCACGACATCCATTCTATGG
>probe:Drosophila_2:1626942_at:254:273; Interrogation_Position=506; Antisense; CATTCTATGGCCGACTGGGCGTTAA
>probe:Drosophila_2:1626942_at:406:593; Interrogation_Position=521; Antisense; TGGGCGTTAATTCCGGCGTTATGCT
>probe:Drosophila_2:1626942_at:232:527; Interrogation_Position=578; Antisense; GGGAACAGCATATCGTGTCTATTCA
>probe:Drosophila_2:1626942_at:290:655; Interrogation_Position=675; Antisense; TAAGCTGTACATCATGCCATGCGAA
>probe:Drosophila_2:1626942_at:232:51; Interrogation_Position=693; Antisense; ATGCGAATACAACTACCGTCCAGAT
>probe:Drosophila_2:1626942_at:67:133; Interrogation_Position=707; Antisense; ACCGTCCAGATCACTGCATGTACAT
>probe:Drosophila_2:1626942_at:94:361; Interrogation_Position=740; Antisense; GCAATATGTCTCAAACTGGCGTTAA
>probe:Drosophila_2:1626942_at:267:541; Interrogation_Position=784; Antisense; GGTTATTTCCATTCAGACAGGCAGC
>probe:Drosophila_2:1626942_at:495:399; Interrogation_Position=799; Antisense; GACAGGCAGCCACTCTTTAAGAGTA
>probe:Drosophila_2:1626942_at:695:387; Interrogation_Position=838; Antisense; GAAAACTACCAACTGGGCTCCAACG
>probe:Drosophila_2:1626942_at:622:131; Interrogation_Position=868; Antisense; ACCGAATTCCTAATGCCCTTGCATG
>probe:Drosophila_2:1626942_at:197:113; Interrogation_Position=894; Antisense; AGCACTCAGTATACCATCCATCAAG

Paste this into a BLAST search page for me
TGAGACGCAAATGTCCGCACTGACGGATTTGCACGACATCCATTCTATGGCATTCTATGGCCGACTGGGCGTTAATGGGCGTTAATTCCGGCGTTATGCTGGGAACAGCATATCGTGTCTATTCATAAGCTGTACATCATGCCATGCGAAATGCGAATACAACTACCGTCCAGATACCGTCCAGATCACTGCATGTACATGCAATATGTCTCAAACTGGCGTTAAGGTTATTTCCATTCAGACAGGCAGCGACAGGCAGCCACTCTTTAAGAGTAGAAAACTACCAACTGGGCTCCAACGACCGAATTCCTAATGCCCTTGCATGAGCACTCAGTATACCATCCATCAAG

Full Affymetrix probeset data:

Annotations for 1626942_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720