FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626943_at:

>probe:Drosophila_2:1626943_at:522:703; Interrogation_Position=1500; Antisense; TTTTGGAGATCCTTCGTCACATTGA
>probe:Drosophila_2:1626943_at:183:263; Interrogation_Position=1529; Antisense; CAGCCCAAATTACTACGTGCGCAGT
>probe:Drosophila_2:1626943_at:67:351; Interrogation_Position=1549; Antisense; GCAGTATCCCAACTCGTACTTGAAG
>probe:Drosophila_2:1626943_at:618:487; Interrogation_Position=1564; Antisense; GTACTTGAAGCTCCCGTTGCTAAAA
>probe:Drosophila_2:1626943_at:268:53; Interrogation_Position=1595; Antisense; ATGCTGAACATGAGGGCTGCTGCCC
>probe:Drosophila_2:1626943_at:55:285; Interrogation_Position=1611; Antisense; CTGCTGCCCCAGAGATTTTCGAGGA
>probe:Drosophila_2:1626943_at:332:51; Interrogation_Position=1695; Antisense; ATGCAGTTGAGCTCAAACCGGCGAC
>probe:Drosophila_2:1626943_at:624:199; Interrogation_Position=1710; Antisense; AACCGGCGACCATCAAGCGAAATGT
>probe:Drosophila_2:1626943_at:532:437; Interrogation_Position=1736; Antisense; GAGGAATACCATGCCGACTTCCTGG
>probe:Drosophila_2:1626943_at:435:631; Interrogation_Position=1755; Antisense; TCCTGGCCAGCCTAGATATGTACGA
>probe:Drosophila_2:1626943_at:625:187; Interrogation_Position=1807; Antisense; AACAGCTCCCGAGGATGACATCCTG
>probe:Drosophila_2:1626943_at:490:387; Interrogation_Position=1837; Antisense; GAACAAGACCATGGCCAATGTACCC
>probe:Drosophila_2:1626943_at:215:227; Interrogation_Position=1877; Antisense; AAGGCCCAAAGTGCCAAGCTTGTGG
>probe:Drosophila_2:1626943_at:438:677; Interrogation_Position=1940; Antisense; TAGGTATTCGATTTGCAGCTGTTGC

Paste this into a BLAST search page for me
TTTTGGAGATCCTTCGTCACATTGACAGCCCAAATTACTACGTGCGCAGTGCAGTATCCCAACTCGTACTTGAAGGTACTTGAAGCTCCCGTTGCTAAAAATGCTGAACATGAGGGCTGCTGCCCCTGCTGCCCCAGAGATTTTCGAGGAATGCAGTTGAGCTCAAACCGGCGACAACCGGCGACCATCAAGCGAAATGTGAGGAATACCATGCCGACTTCCTGGTCCTGGCCAGCCTAGATATGTACGAAACAGCTCCCGAGGATGACATCCTGGAACAAGACCATGGCCAATGTACCCAAGGCCCAAAGTGCCAAGCTTGTGGTAGGTATTCGATTTGCAGCTGTTGC

Full Affymetrix probeset data:

Annotations for 1626943_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720