FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626945_at:

>probe:Drosophila_2:1626945_at:266:371; Interrogation_Position=1234; Antisense; GAAGGCTCGCTCCAAAAACAAGGAT
>probe:Drosophila_2:1626945_at:217:251; Interrogation_Position=1252; Antisense; CAAGGATGTTCATGCGGCCGAGACT
>probe:Drosophila_2:1626945_at:597:1; Interrogation_Position=1326; Antisense; AGGAGGAGTTGATCGGTTTCCGCAA
>probe:Drosophila_2:1626945_at:388:201; Interrogation_Position=1349; Antisense; AACCGACGGGTAGCTGCTTTCAAGA
>probe:Drosophila_2:1626945_at:515:109; Interrogation_Position=1371; Antisense; AGAAGAGCCTCGTCGAGCTCTCAGA
>probe:Drosophila_2:1626945_at:361:365; Interrogation_Position=1427; Antisense; GAATATCTGCGCCAATCACTGCTAG
>probe:Drosophila_2:1626945_at:93:677; Interrogation_Position=1499; Antisense; TAGAAGGATGAGTCACCCGCACATT
>probe:Drosophila_2:1626945_at:13:151; Interrogation_Position=1519; Antisense; ACATTGTTTACACACCCCATTGAAA
>probe:Drosophila_2:1626945_at:98:391; Interrogation_Position=1540; Antisense; GAAACGCAAGCCTCATCGATTACAC
>probe:Drosophila_2:1626945_at:429:41; Interrogation_Position=1554; Antisense; ATCGATTACACACATCCGGGAGACG
>probe:Drosophila_2:1626945_at:698:357; Interrogation_Position=1640; Antisense; GCAACATTATTATCTTAGCCCACGT
>probe:Drosophila_2:1626945_at:350:265; Interrogation_Position=1698; Antisense; CAGAGCGCTTTTATATTTGTCAAAC
>probe:Drosophila_2:1626945_at:294:725; Interrogation_Position=1714; Antisense; TTGTCAAACAAGCATTCCTCTCTAC
>probe:Drosophila_2:1626945_at:350:345; Interrogation_Position=1725; Antisense; GCATTCCTCTCTACAGCATAAACTA

Paste this into a BLAST search page for me
GAAGGCTCGCTCCAAAAACAAGGATCAAGGATGTTCATGCGGCCGAGACTAGGAGGAGTTGATCGGTTTCCGCAAAACCGACGGGTAGCTGCTTTCAAGAAGAAGAGCCTCGTCGAGCTCTCAGAGAATATCTGCGCCAATCACTGCTAGTAGAAGGATGAGTCACCCGCACATTACATTGTTTACACACCCCATTGAAAGAAACGCAAGCCTCATCGATTACACATCGATTACACACATCCGGGAGACGGCAACATTATTATCTTAGCCCACGTCAGAGCGCTTTTATATTTGTCAAACTTGTCAAACAAGCATTCCTCTCTACGCATTCCTCTCTACAGCATAAACTA

Full Affymetrix probeset data:

Annotations for 1626945_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720