Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626946_at:

>probe:Drosophila_2:1626946_at:558:681; Interrogation_Position=3156; Antisense; TATGATCGCGAAATGGAATGCACCG
>probe:Drosophila_2:1626946_at:174:369; Interrogation_Position=3171; Antisense; GAATGCACCGCGTTGGAGGTCTATT
>probe:Drosophila_2:1626946_at:698:587; Interrogation_Position=3184; Antisense; TGGAGGTCTATTTCCATTCTTTTTT
>probe:Drosophila_2:1626946_at:690:547; Interrogation_Position=3293; Antisense; GGAGTTACAAGTTTATACAGCCCAA
>probe:Drosophila_2:1626946_at:653:687; Interrogation_Position=3352; Antisense; TATAGGCCTAGCTTAAGCCGCCAGG
>probe:Drosophila_2:1626946_at:603:659; Interrogation_Position=3365; Antisense; TAAGCCGCCAGGATCAACGAAGTAA
>probe:Drosophila_2:1626946_at:510:165; Interrogation_Position=3436; Antisense; AAATCCAGAGAGTAAATGCATGCGA
>probe:Drosophila_2:1626946_at:622:231; Interrogation_Position=3450; Antisense; AATGCATGCGAGGATTGCGAAAAGT
>probe:Drosophila_2:1626946_at:355:427; Interrogation_Position=3501; Antisense; GAGTTTTTAAATGCAATACGTAGAC
>probe:Drosophila_2:1626946_at:546:675; Interrogation_Position=3521; Antisense; TAGACCATTACGTGGTACAGCCAGG
>probe:Drosophila_2:1626946_at:123:529; Interrogation_Position=3548; Antisense; GGCGTTGGGTGGCAATCAACCCAAA
>probe:Drosophila_2:1626946_at:401:493; Interrogation_Position=3607; Antisense; GTAAGAGGAGAACAGAGCTGCACCA
>probe:Drosophila_2:1626946_at:701:127; Interrogation_Position=3646; Antisense; ACCATAGAACTGGTGGTTTGGACCA
>probe:Drosophila_2:1626946_at:346:539; Interrogation_Position=3660; Antisense; GGTTTGGACCAGCTCAGCATATCAT

Paste this into a BLAST search page for me
TATGATCGCGAAATGGAATGCACCGGAATGCACCGCGTTGGAGGTCTATTTGGAGGTCTATTTCCATTCTTTTTTGGAGTTACAAGTTTATACAGCCCAATATAGGCCTAGCTTAAGCCGCCAGGTAAGCCGCCAGGATCAACGAAGTAAAAATCCAGAGAGTAAATGCATGCGAAATGCATGCGAGGATTGCGAAAAGTGAGTTTTTAAATGCAATACGTAGACTAGACCATTACGTGGTACAGCCAGGGGCGTTGGGTGGCAATCAACCCAAAGTAAGAGGAGAACAGAGCTGCACCAACCATAGAACTGGTGGTTTGGACCAGGTTTGGACCAGCTCAGCATATCAT

Full Affymetrix probeset data:

Annotations for 1626946_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime