FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626948_at:

>probe:Drosophila_2:1626948_at:371:149; Interrogation_Position=285; Antisense; ACTTCATCCCATGGCCTTCGATATG
>probe:Drosophila_2:1626948_at:559:681; Interrogation_Position=306; Antisense; TATGTTCGAGAATGGCAGCCTGCTG
>probe:Drosophila_2:1626948_at:630:321; Interrogation_Position=336; Antisense; GCGAAAACGTTTCCGCGTCAAGCAG
>probe:Drosophila_2:1626948_at:422:99; Interrogation_Position=410; Antisense; AGATGGTGACCCACTATCTGGACGA
>probe:Drosophila_2:1626948_at:237:453; Interrogation_Position=433; Antisense; GATCAGCTAACGCAGATGGCCTTTG
>probe:Drosophila_2:1626948_at:163:63; Interrogation_Position=479; Antisense; ATGTGCTCGCCAATGCATCTGCTGC
>probe:Drosophila_2:1626948_at:629:173; Interrogation_Position=573; Antisense; AAAGCGCGCCTTCACCATCGAGAGT
>probe:Drosophila_2:1626948_at:52:43; Interrogation_Position=589; Antisense; ATCGAGAGTCTCATGGCTCCGGATC
>probe:Drosophila_2:1626948_at:68:677; Interrogation_Position=638; Antisense; TAGTGCCCATGGAGTACGGCAGTCC
>probe:Drosophila_2:1626948_at:644:633; Interrogation_Position=660; Antisense; TCCCGATGCCGTCGCGTTGGAAAAG
>probe:Drosophila_2:1626948_at:118:387; Interrogation_Position=679; Antisense; GAAAAGCCGCCGTTTAATTTGCCAT
>probe:Drosophila_2:1626948_at:482:13; Interrogation_Position=702; Antisense; ATTCAATTTCAACGAACTCGCCGCG
>probe:Drosophila_2:1626948_at:566:193; Interrogation_Position=716; Antisense; AACTCGCCGCGCAGTATCAGTTATA
>probe:Drosophila_2:1626948_at:522:25; Interrogation_Position=778; Antisense; ATACCTTGCTACCAGAAAACACCGC

Paste this into a BLAST search page for me
ACTTCATCCCATGGCCTTCGATATGTATGTTCGAGAATGGCAGCCTGCTGGCGAAAACGTTTCCGCGTCAAGCAGAGATGGTGACCCACTATCTGGACGAGATCAGCTAACGCAGATGGCCTTTGATGTGCTCGCCAATGCATCTGCTGCAAAGCGCGCCTTCACCATCGAGAGTATCGAGAGTCTCATGGCTCCGGATCTAGTGCCCATGGAGTACGGCAGTCCTCCCGATGCCGTCGCGTTGGAAAAGGAAAAGCCGCCGTTTAATTTGCCATATTCAATTTCAACGAACTCGCCGCGAACTCGCCGCGCAGTATCAGTTATAATACCTTGCTACCAGAAAACACCGC

Full Affymetrix probeset data:

Annotations for 1626948_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720