FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626949_at:

>probe:Drosophila_2:1626949_at:31:531; Interrogation_Position=1074; Antisense; GGGATTCCTTCCCAATGCCGATATC
>probe:Drosophila_2:1626949_at:82:459; Interrogation_Position=1093; Antisense; GATATCGCACAACTATGCGCTTAGC
>probe:Drosophila_2:1626949_at:400:271; Interrogation_Position=1130; Antisense; CATATCACGTTTACCGCAATTTCCA
>probe:Drosophila_2:1626949_at:554:359; Interrogation_Position=1145; Antisense; GCAATTTCCAAAACCCTTTCATACG
>probe:Drosophila_2:1626949_at:357:81; Interrogation_Position=1192; Antisense; AGGTGATCTATGACTTGGCCACAGA
>probe:Drosophila_2:1626949_at:197:59; Interrogation_Position=1279; Antisense; ATGATGATAGCCCAATTACCGAGAT
>probe:Drosophila_2:1626949_at:86:243; Interrogation_Position=1313; Antisense; AATAGCAATCACCTGTCATACGAGT
>probe:Drosophila_2:1626949_at:165:467; Interrogation_Position=1338; Antisense; GATTGGCCAAATGATCTCTTGCATC
>probe:Drosophila_2:1626949_at:48:679; Interrogation_Position=1374; Antisense; TAGATGGAACCATCGTGTGTCCCGC
>probe:Drosophila_2:1626949_at:706:299; Interrogation_Position=1396; Antisense; CGCCCACGTCCATTTGAAACTACAA
>probe:Drosophila_2:1626949_at:253:237; Interrogation_Position=1478; Antisense; AATCGATCTGATGCGAGTGTTCAAA
>probe:Drosophila_2:1626949_at:595:663; Interrogation_Position=1517; Antisense; TAAATCTACATGCTTGACTACCAAC
>probe:Drosophila_2:1626949_at:442:89; Interrogation_Position=1562; Antisense; AGTAATGCCCATTTCCCAAGGAAGT
>probe:Drosophila_2:1626949_at:499:339; Interrogation_Position=1614; Antisense; GCTACATTGGTCTTACGTTCATACA

Paste this into a BLAST search page for me
GGGATTCCTTCCCAATGCCGATATCGATATCGCACAACTATGCGCTTAGCCATATCACGTTTACCGCAATTTCCAGCAATTTCCAAAACCCTTTCATACGAGGTGATCTATGACTTGGCCACAGAATGATGATAGCCCAATTACCGAGATAATAGCAATCACCTGTCATACGAGTGATTGGCCAAATGATCTCTTGCATCTAGATGGAACCATCGTGTGTCCCGCCGCCCACGTCCATTTGAAACTACAAAATCGATCTGATGCGAGTGTTCAAATAAATCTACATGCTTGACTACCAACAGTAATGCCCATTTCCCAAGGAAGTGCTACATTGGTCTTACGTTCATACA

Full Affymetrix probeset data:

Annotations for 1626949_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720