FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626952_at:

>probe:Drosophila_2:1626952_at:187:267; Interrogation_Position=1022; Antisense; CAGTCCTTATTTTATTGCGGTCATC
>probe:Drosophila_2:1626952_at:442:537; Interrogation_Position=1040; Antisense; GGTCATCACGATGATTGCCTACCTT
>probe:Drosophila_2:1626952_at:177:701; Interrogation_Position=1063; Antisense; TTTTAACTCACCAACTGCCGTGCAA
>probe:Drosophila_2:1626952_at:632:361; Interrogation_Position=1144; Antisense; GAATATAACCCTGACTGTTCTCGAA
>probe:Drosophila_2:1626952_at:164:689; Interrogation_Position=1172; Antisense; TATATTCCACGATTCTTTCGCGGTG
>probe:Drosophila_2:1626952_at:37:719; Interrogation_Position=1188; Antisense; TTCGCGGTGCGAAGCTTATGTATGA
>probe:Drosophila_2:1626952_at:116:201; Interrogation_Position=1256; Antisense; AAGCCGTTCGTAGAGCCCGAGGTCA
>probe:Drosophila_2:1626952_at:543:481; Interrogation_Position=1354; Antisense; GTATTTGGCCCTCAATCTGAAGGAG
>probe:Drosophila_2:1626952_at:180:727; Interrogation_Position=1379; Antisense; TTGGAGGTGCATGGTCTGTTAAACT
>probe:Drosophila_2:1626952_at:230:659; Interrogation_Position=837; Antisense; TAAGTTGGTTCTTTTACGCTCGGAG
>probe:Drosophila_2:1626952_at:375:551; Interrogation_Position=858; Antisense; GGAGTTCCTACAAGAATGCCATCGA
>probe:Drosophila_2:1626952_at:396:635; Interrogation_Position=879; Antisense; TCGAGTACCGAAAGAGGCCCAACCA
>probe:Drosophila_2:1626952_at:219:551; Interrogation_Position=959; Antisense; GGAGATCCCGAGTGCCAATACGTGC
>probe:Drosophila_2:1626952_at:693:139; Interrogation_Position=989; Antisense; ACGGTCAAGGACTCGATTGCCAATT

Paste this into a BLAST search page for me
CAGTCCTTATTTTATTGCGGTCATCGGTCATCACGATGATTGCCTACCTTTTTTAACTCACCAACTGCCGTGCAAGAATATAACCCTGACTGTTCTCGAATATATTCCACGATTCTTTCGCGGTGTTCGCGGTGCGAAGCTTATGTATGAAAGCCGTTCGTAGAGCCCGAGGTCAGTATTTGGCCCTCAATCTGAAGGAGTTGGAGGTGCATGGTCTGTTAAACTTAAGTTGGTTCTTTTACGCTCGGAGGGAGTTCCTACAAGAATGCCATCGATCGAGTACCGAAAGAGGCCCAACCAGGAGATCCCGAGTGCCAATACGTGCACGGTCAAGGACTCGATTGCCAATT

Full Affymetrix probeset data:

Annotations for 1626952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720