FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626953_at:

>probe:Drosophila_2:1626953_at:202:481; Interrogation_Position=1007; Antisense; GTTTGTGCCGCCCAAATGATGGACA
>probe:Drosophila_2:1626953_at:90:559; Interrogation_Position=1027; Antisense; GGACATCCAAGCGAGGTTCATCATG
>probe:Drosophila_2:1626953_at:518:339; Interrogation_Position=1053; Antisense; GCTACTACAACGGATCCAACGAGTT
>probe:Drosophila_2:1626953_at:224:319; Interrogation_Position=1078; Antisense; GCCGTCCACGGAGGATATGCTCAAG
>probe:Drosophila_2:1626953_at:608:681; Interrogation_Position=1093; Antisense; TATGCTCAAGGACACCCGCGATAGG
>probe:Drosophila_2:1626953_at:362:555; Interrogation_Position=1139; Antisense; GGACTAAGAAAACGCCATGCCCACA
>probe:Drosophila_2:1626953_at:700:357; Interrogation_Position=1177; Antisense; GCAAATCGACTATTTCACGGACTTG
>probe:Drosophila_2:1626953_at:476:711; Interrogation_Position=1190; Antisense; TTCACGGACTTGTCGCAAACTGCAG
>probe:Drosophila_2:1626953_at:192:229; Interrogation_Position=1274; Antisense; AATGAGAATTTGCTCCACTTCCGGG
>probe:Drosophila_2:1626953_at:253:715; Interrogation_Position=1292; Antisense; TTCCGGGAGGACAATTTCGCGATTC
>probe:Drosophila_2:1626953_at:75:717; Interrogation_Position=1307; Antisense; TTCGCGATTCTGGACGACGAGACAT
>probe:Drosophila_2:1626953_at:505:351; Interrogation_Position=867; Antisense; GCACAGGTTACAAGTACGCCTTTCC
>probe:Drosophila_2:1626953_at:562:349; Interrogation_Position=952; Antisense; GCAGTGCATCAACATCAGGAACCCA
>probe:Drosophila_2:1626953_at:696:41; Interrogation_Position=989; Antisense; ATCGGACTGCCGTTTTACGTTTGTG

Paste this into a BLAST search page for me
GTTTGTGCCGCCCAAATGATGGACAGGACATCCAAGCGAGGTTCATCATGGCTACTACAACGGATCCAACGAGTTGCCGTCCACGGAGGATATGCTCAAGTATGCTCAAGGACACCCGCGATAGGGGACTAAGAAAACGCCATGCCCACAGCAAATCGACTATTTCACGGACTTGTTCACGGACTTGTCGCAAACTGCAGAATGAGAATTTGCTCCACTTCCGGGTTCCGGGAGGACAATTTCGCGATTCTTCGCGATTCTGGACGACGAGACATGCACAGGTTACAAGTACGCCTTTCCGCAGTGCATCAACATCAGGAACCCAATCGGACTGCCGTTTTACGTTTGTG

Full Affymetrix probeset data:

Annotations for 1626953_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720