FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626955_at:

>probe:Drosophila_2:1626955_at:375:31; Interrogation_Position=1051; Antisense; ATAAGAAGTCCACAGTTCCCTGTCG
>probe:Drosophila_2:1626955_at:572:529; Interrogation_Position=1096; Antisense; GGGATCACAGAACTCCTTGATGTTT
>probe:Drosophila_2:1626955_at:418:605; Interrogation_Position=1113; Antisense; TGATGTTTTCCCCACTTTGGTGGAT
>probe:Drosophila_2:1626955_at:526:531; Interrogation_Position=1131; Antisense; GGTGGATCTGGCAGGATTACCCAAA
>probe:Drosophila_2:1626955_at:160:49; Interrogation_Position=1164; Antisense; ATGCCAGAGCTCTCAGGAGTTGACC
>probe:Drosophila_2:1626955_at:389:389; Interrogation_Position=1199; Antisense; GAAAAAGTCTTTACCATCAGCTGAT
>probe:Drosophila_2:1626955_at:14:57; Interrogation_Position=1241; Antisense; ATGAGCACGTGGCTCTCAGTCAGTA
>probe:Drosophila_2:1626955_at:633:211; Interrogation_Position=1269; Antisense; AAGACCAGGAATGCTGCCCACAAAG
>probe:Drosophila_2:1626955_at:433:647; Interrogation_Position=1334; Antisense; TCATGGGCTATAGTCTCAGAACCGA
>probe:Drosophila_2:1626955_at:190:533; Interrogation_Position=1380; Antisense; GGTGAGGTTCCATGCGCAAAACTTT
>probe:Drosophila_2:1626955_at:284:549; Interrogation_Position=1434; Antisense; GGAGTTGTACGACCACCGCCTGGAT
>probe:Drosophila_2:1626955_at:633:435; Interrogation_Position=1465; Antisense; GAGGAATTGAACCTGATGCCCCTGC
>probe:Drosophila_2:1626955_at:14:95; Interrogation_Position=1493; Antisense; AGTTCGATGATGTGCGTCAGCGCCT
>probe:Drosophila_2:1626955_at:423:117; Interrogation_Position=1546; Antisense; AGCTAGTGGAGATCGGCTGTCCCTT

Paste this into a BLAST search page for me
ATAAGAAGTCCACAGTTCCCTGTCGGGGATCACAGAACTCCTTGATGTTTTGATGTTTTCCCCACTTTGGTGGATGGTGGATCTGGCAGGATTACCCAAAATGCCAGAGCTCTCAGGAGTTGACCGAAAAAGTCTTTACCATCAGCTGATATGAGCACGTGGCTCTCAGTCAGTAAAGACCAGGAATGCTGCCCACAAAGTCATGGGCTATAGTCTCAGAACCGAGGTGAGGTTCCATGCGCAAAACTTTGGAGTTGTACGACCACCGCCTGGATGAGGAATTGAACCTGATGCCCCTGCAGTTCGATGATGTGCGTCAGCGCCTAGCTAGTGGAGATCGGCTGTCCCTT

Full Affymetrix probeset data:

Annotations for 1626955_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720