FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626957_at:

>probe:Drosophila_2:1626957_at:427:187; Interrogation_Position=1050; Antisense; AACACCGCCGTAATGCAGTTCAAAA
>probe:Drosophila_2:1626957_at:125:183; Interrogation_Position=1072; Antisense; AAAAGGGTAGCTTCGCGGTCAGCGA
>probe:Drosophila_2:1626957_at:495:647; Interrogation_Position=1103; Antisense; TCATCCAGTGGCCATTCGATACGAT
>probe:Drosophila_2:1626957_at:202:715; Interrogation_Position=1134; Antisense; TTCGGCGAGGCCTATTGGGACAGCA
>probe:Drosophila_2:1626957_at:207:133; Interrogation_Position=1158; Antisense; ACCCGTTACTCTATGCTCAGATACA
>probe:Drosophila_2:1626957_at:288:431; Interrogation_Position=1218; Antisense; GATGTTTGGTACATGCCGGCACTCA
>probe:Drosophila_2:1626957_at:692:429; Interrogation_Position=1257; Antisense; GAGTCCCCAGTAGAGTTTTCGAATC
>probe:Drosophila_2:1626957_at:544:323; Interrogation_Position=1308; Antisense; GCGAATATCGATGATCTGCCCTGGG
>probe:Drosophila_2:1626957_at:60:661; Interrogation_Position=1342; Antisense; TAAAACGCTGGAGTCCCGTCAGGGA
>probe:Drosophila_2:1626957_at:334:79; Interrogation_Position=1391; Antisense; AGGTTCTTACCTTGGCTATTTCATA
>probe:Drosophila_2:1626957_at:463:341; Interrogation_Position=1405; Antisense; GCTATTTCATATCGCCGTTTGCAAT
>probe:Drosophila_2:1626957_at:39:481; Interrogation_Position=1421; Antisense; GTTTGCAATACCGTACGCTGTTGGT
>probe:Drosophila_2:1626957_at:527:127; Interrogation_Position=925; Antisense; ACCACATGTGGTTCGACCGCAAGGA
>probe:Drosophila_2:1626957_at:499:73; Interrogation_Position=946; Antisense; AGGAACTGGCCGATCGTGAGGCTCT

Paste this into a BLAST search page for me
AACACCGCCGTAATGCAGTTCAAAAAAAAGGGTAGCTTCGCGGTCAGCGATCATCCAGTGGCCATTCGATACGATTTCGGCGAGGCCTATTGGGACAGCAACCCGTTACTCTATGCTCAGATACAGATGTTTGGTACATGCCGGCACTCAGAGTCCCCAGTAGAGTTTTCGAATCGCGAATATCGATGATCTGCCCTGGGTAAAACGCTGGAGTCCCGTCAGGGAAGGTTCTTACCTTGGCTATTTCATAGCTATTTCATATCGCCGTTTGCAATGTTTGCAATACCGTACGCTGTTGGTACCACATGTGGTTCGACCGCAAGGAAGGAACTGGCCGATCGTGAGGCTCT

Full Affymetrix probeset data:

Annotations for 1626957_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720