FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626959_at:

>probe:Drosophila_2:1626959_at:185:77; Interrogation_Position=113; Antisense; AGGAGAACATCCACCATTGCTGCAA
>probe:Drosophila_2:1626959_at:70:139; Interrogation_Position=155; Antisense; ACGATGTCACGGAATCTTGCGCCAA
>probe:Drosophila_2:1626959_at:391:209; Interrogation_Position=178; Antisense; AAGCAGACCAACTTTCGTTTGCCCA
>probe:Drosophila_2:1626959_at:580:65; Interrogation_Position=247; Antisense; ATGGTTGGAACCTGCTGGGCCAAGT
>probe:Drosophila_2:1626959_at:391:507; Interrogation_Position=270; Antisense; GTGCGTCTTCGATCACTACAATCTG
>probe:Drosophila_2:1626959_at:547:559; Interrogation_Position=318; Antisense; GGACAAGGTGCGCTCGTACTACAAG
>probe:Drosophila_2:1626959_at:502:255; Interrogation_Position=439; Antisense; TCACTTCCAATTGTTAGGGCCTTCT
>probe:Drosophila_2:1626959_at:411:251; Interrogation_Position=471; Antisense; CAAGTTCTGTAAGCCGACCTCGAGT
>probe:Drosophila_2:1626959_at:530:637; Interrogation_Position=490; Antisense; TCGAGTATCATCATGTCCTGCGTCA
>probe:Drosophila_2:1626959_at:636:143; Interrogation_Position=51; Antisense; ACTGCGCTTGAATGGACTCGTGGCT
>probe:Drosophila_2:1626959_at:678:191; Interrogation_Position=520; Antisense; AACTTCTTCCACAATTGTCCAGCGA
>probe:Drosophila_2:1626959_at:593:431; Interrogation_Position=543; Antisense; GAGTCGCTGGTCAAATACCACCGAG
>probe:Drosophila_2:1626959_at:667:429; Interrogation_Position=565; Antisense; GAGTGCGTGGAAACCTTGGCCTTTG
>probe:Drosophila_2:1626959_at:215:723; Interrogation_Position=87; Antisense; TTGCCGGCACATGGAGCGTATTCAC

Paste this into a BLAST search page for me
AGGAGAACATCCACCATTGCTGCAAACGATGTCACGGAATCTTGCGCCAAAAGCAGACCAACTTTCGTTTGCCCAATGGTTGGAACCTGCTGGGCCAAGTGTGCGTCTTCGATCACTACAATCTGGGACAAGGTGCGCTCGTACTACAAGTCACTTCCAATTGTTAGGGCCTTCTCAAGTTCTGTAAGCCGACCTCGAGTTCGAGTATCATCATGTCCTGCGTCAACTGCGCTTGAATGGACTCGTGGCTAACTTCTTCCACAATTGTCCAGCGAGAGTCGCTGGTCAAATACCACCGAGGAGTGCGTGGAAACCTTGGCCTTTGTTGCCGGCACATGGAGCGTATTCAC

Full Affymetrix probeset data:

Annotations for 1626959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720