Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626962_x_at:

>probe:Drosophila_2:1626962_x_at:607:417; Interrogation_Position=117; Antisense; GAGCTGTCAAATCCATGTACCCCTG
>probe:Drosophila_2:1626962_x_at:685:301; Interrogation_Position=137; Antisense; CCCTGCCCGACTCGAAATATATTCA
>probe:Drosophila_2:1626962_x_at:374:605; Interrogation_Position=14; Antisense; TGATGCAGCAACGAATTTCCGGATT
>probe:Drosophila_2:1626962_x_at:88:23; Interrogation_Position=153; Antisense; ATATATTCAGTTTGCCACCAGAGCT
>probe:Drosophila_2:1626962_x_at:714:721; Interrogation_Position=164; Antisense; TTGCCACCAGAGCTCGTCTGGAGCA
>probe:Drosophila_2:1626962_x_at:367:499; Interrogation_Position=179; Antisense; GTCTGGAGCACAACTCGTTTCGGAA
>probe:Drosophila_2:1626962_x_at:66:159; Interrogation_Position=226; Antisense; ACAAAATTCATAGTAAAGCGACGGA
>probe:Drosophila_2:1626962_x_at:687:363; Interrogation_Position=26; Antisense; GAATTTCCGGATTTTGGCAGGGCCA
>probe:Drosophila_2:1626962_x_at:626:701; Interrogation_Position=37; Antisense; TTTTGGCAGGGCCAACTGCCTGTAT
>probe:Drosophila_2:1626962_x_at:29:311; Interrogation_Position=48; Antisense; CCAACTGCCTGTATACCGCTTAAAA
>probe:Drosophila_2:1626962_x_at:621:313; Interrogation_Position=54; Antisense; GCCTGTATACCGCTTAAAATTCCTG
>probe:Drosophila_2:1626962_x_at:389:481; Interrogation_Position=58; Antisense; GTATACCGCTTAAAATTCCTGATCA
>probe:Drosophila_2:1626962_x_at:617:303; Interrogation_Position=63; Antisense; CCGCTTAAAATTCCTGATCACATTG
>probe:Drosophila_2:1626962_x_at:167:5; Interrogation_Position=84; Antisense; ATTGTCCTTGGAACTAATTTCATCG

Paste this into a BLAST search page for me
GAGCTGTCAAATCCATGTACCCCTGCCCTGCCCGACTCGAAATATATTCATGATGCAGCAACGAATTTCCGGATTATATATTCAGTTTGCCACCAGAGCTTTGCCACCAGAGCTCGTCTGGAGCAGTCTGGAGCACAACTCGTTTCGGAAACAAAATTCATAGTAAAGCGACGGAGAATTTCCGGATTTTGGCAGGGCCATTTTGGCAGGGCCAACTGCCTGTATCCAACTGCCTGTATACCGCTTAAAAGCCTGTATACCGCTTAAAATTCCTGGTATACCGCTTAAAATTCCTGATCACCGCTTAAAATTCCTGATCACATTGATTGTCCTTGGAACTAATTTCATCG

Full Affymetrix probeset data:

Annotations for 1626962_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime