FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626963_at:

>probe:Drosophila_2:1626963_at:693:515; Interrogation_Position=1095; Antisense; GTGTGGCAACTTTTACTACGACTAG
>probe:Drosophila_2:1626963_at:155:251; Interrogation_Position=562; Antisense; CAATCGTCACTGCTTCGGAAGAGGC
>probe:Drosophila_2:1626963_at:387:561; Interrogation_Position=626; Antisense; GGAACATCCTGGTCGTGGACGCCAA
>probe:Drosophila_2:1626963_at:630:211; Interrogation_Position=649; Antisense; AAGAGGTCCCCAGGAATGGCACACC
>probe:Drosophila_2:1626963_at:223:287; Interrogation_Position=677; Antisense; CTGGTGGAGCGGATCAACCTCTGAA
>probe:Drosophila_2:1626963_at:41:389; Interrogation_Position=699; Antisense; GAAAAGCACTTCACCTGGACGGGAG
>probe:Drosophila_2:1626963_at:185:409; Interrogation_Position=727; Antisense; GACGTCTACCGTCCGAGAATCAAGA
>probe:Drosophila_2:1626963_at:542:365; Interrogation_Position=743; Antisense; GAATCAAGATGAGTGGCCGGTCCAA
>probe:Drosophila_2:1626963_at:656:51; Interrogation_Position=841; Antisense; ATGCAGATGCGCCAGGAGAAGCTCT
>probe:Drosophila_2:1626963_at:276:109; Interrogation_Position=857; Antisense; AGAAGCTCTGTCAGCAGCCGGAGTA
>probe:Drosophila_2:1626963_at:130:669; Interrogation_Position=880; Antisense; TACTACGACCAGTATATCCGCATGC
>probe:Drosophila_2:1626963_at:664:495; Interrogation_Position=920; Antisense; GTCACCAGCAGATGTGCCAGCACGA
>probe:Drosophila_2:1626963_at:634:111; Interrogation_Position=947; Antisense; AGCAGAAGCAGGACTTTGCCCGTCA
>probe:Drosophila_2:1626963_at:51:693; Interrogation_Position=961; Antisense; TTTGCCCGTCAGAGGTACCATGTGA

Paste this into a BLAST search page for me
GTGTGGCAACTTTTACTACGACTAGCAATCGTCACTGCTTCGGAAGAGGCGGAACATCCTGGTCGTGGACGCCAAAAGAGGTCCCCAGGAATGGCACACCCTGGTGGAGCGGATCAACCTCTGAAGAAAAGCACTTCACCTGGACGGGAGGACGTCTACCGTCCGAGAATCAAGAGAATCAAGATGAGTGGCCGGTCCAAATGCAGATGCGCCAGGAGAAGCTCTAGAAGCTCTGTCAGCAGCCGGAGTATACTACGACCAGTATATCCGCATGCGTCACCAGCAGATGTGCCAGCACGAAGCAGAAGCAGGACTTTGCCCGTCATTTGCCCGTCAGAGGTACCATGTGA

Full Affymetrix probeset data:

Annotations for 1626963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720