FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626964_at:

>probe:Drosophila_2:1626964_at:410:385; Interrogation_Position=108; Antisense; GAACAGATCCGTTCCCCAATGGGTT
>probe:Drosophila_2:1626964_at:54:229; Interrogation_Position=125; Antisense; AATGGGTTCGCCTACGTACTGGCAA
>probe:Drosophila_2:1626964_at:38:489; Interrogation_Position=140; Antisense; GTACTGGCAACACTATTCGTTACAA
>probe:Drosophila_2:1626964_at:365:689; Interrogation_Position=153; Antisense; TATTCGTTACAACGCTAAGCGCCGT
>probe:Drosophila_2:1626964_at:402:643; Interrogation_Position=16; Antisense; TCTTTCCGGTGTGGCTCGTTGAAAA
>probe:Drosophila_2:1626964_at:223:319; Interrogation_Position=173; Antisense; GCCGTCACTGGAGGCGTACCAAGTT
>probe:Drosophila_2:1626964_at:147:437; Interrogation_Position=183; Antisense; GAGGCGTACCAAGTTGAAGCTGTAA
>probe:Drosophila_2:1626964_at:72:121; Interrogation_Position=207; Antisense; AGCTGTTGATTCCAGGAGTTCCGCA
>probe:Drosophila_2:1626964_at:231:429; Interrogation_Position=222; Antisense; GAGTTCCGCAATTTTGTGGAATGCT
>probe:Drosophila_2:1626964_at:194:563; Interrogation_Position=239; Antisense; GGAATGCTGAAGATCTTTTCGAGAA
>probe:Drosophila_2:1626964_at:288:245; Interrogation_Position=276; Antisense; AATTCGTCTACAATTTGCGGATTAA
>probe:Drosophila_2:1626964_at:502:95; Interrogation_Position=40; Antisense; AGATTGGACGAAATGGCTGCACACA
>probe:Drosophila_2:1626964_at:674:67; Interrogation_Position=52; Antisense; ATGGCTGCACACAAGTCGTTCAGAA
>probe:Drosophila_2:1626964_at:454:377; Interrogation_Position=96; Antisense; GAAGCTGAAGCAGAACAGATCCGTT

Paste this into a BLAST search page for me
GAACAGATCCGTTCCCCAATGGGTTAATGGGTTCGCCTACGTACTGGCAAGTACTGGCAACACTATTCGTTACAATATTCGTTACAACGCTAAGCGCCGTTCTTTCCGGTGTGGCTCGTTGAAAAGCCGTCACTGGAGGCGTACCAAGTTGAGGCGTACCAAGTTGAAGCTGTAAAGCTGTTGATTCCAGGAGTTCCGCAGAGTTCCGCAATTTTGTGGAATGCTGGAATGCTGAAGATCTTTTCGAGAAAATTCGTCTACAATTTGCGGATTAAAGATTGGACGAAATGGCTGCACACAATGGCTGCACACAAGTCGTTCAGAAGAAGCTGAAGCAGAACAGATCCGTT

Full Affymetrix probeset data:

Annotations for 1626964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720