FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626965_at:

>probe:Drosophila_2:1626965_at:395:205; Interrogation_Position=1688; Antisense; AAGCTGTGCAATCCCTGTGTAATGA
>probe:Drosophila_2:1626965_at:46:241; Interrogation_Position=1731; Antisense; AATACGACACTCTCTTGGATGACTC
>probe:Drosophila_2:1626965_at:206:583; Interrogation_Position=1773; Antisense; TGGCTGGAGCCGACAATCTAACATT
>probe:Drosophila_2:1626965_at:639:635; Interrogation_Position=1825; Antisense; TCGAGCCAATCTGCGCAACTATTTC
>probe:Drosophila_2:1626965_at:348:271; Interrogation_Position=1861; Antisense; CATCGGTGCCATACGCAAGTTGTAC
>probe:Drosophila_2:1626965_at:51:545; Interrogation_Position=1897; Antisense; GGATGACTTTCGACTCTTTGACTAC
>probe:Drosophila_2:1626965_at:63:703; Interrogation_Position=1914; Antisense; TTGACTACGCACTGGACGAGGTACT
>probe:Drosophila_2:1626965_at:488:75; Interrogation_Position=1932; Antisense; AGGTACTCGGCTTTGAGTTTGGCTA
>probe:Drosophila_2:1626965_at:240:613; Interrogation_Position=1965; Antisense; TGAAAAGCTGCTCTCTCAATATCCC
>probe:Drosophila_2:1626965_at:511:261; Interrogation_Position=1998; Antisense; CACCATAACGCTTTCCACTGGAAAA
>probe:Drosophila_2:1626965_at:526:401; Interrogation_Position=2042; Antisense; GACTTGTAGATTTAGGTGCACTCCC
>probe:Drosophila_2:1626965_at:384:535; Interrogation_Position=2056; Antisense; GGTGCACTCCCATGCGAATATTATT
>probe:Drosophila_2:1626965_at:100:723; Interrogation_Position=2082; Antisense; TTGTTCTGTATACATACCTTCCCGC
>probe:Drosophila_2:1626965_at:703:719; Interrogation_Position=2100; Antisense; TTCCCGCGCACAAATGTTTCCAAGG

Paste this into a BLAST search page for me
AAGCTGTGCAATCCCTGTGTAATGAAATACGACACTCTCTTGGATGACTCTGGCTGGAGCCGACAATCTAACATTTCGAGCCAATCTGCGCAACTATTTCCATCGGTGCCATACGCAAGTTGTACGGATGACTTTCGACTCTTTGACTACTTGACTACGCACTGGACGAGGTACTAGGTACTCGGCTTTGAGTTTGGCTATGAAAAGCTGCTCTCTCAATATCCCCACCATAACGCTTTCCACTGGAAAAGACTTGTAGATTTAGGTGCACTCCCGGTGCACTCCCATGCGAATATTATTTTGTTCTGTATACATACCTTCCCGCTTCCCGCGCACAAATGTTTCCAAGG

Full Affymetrix probeset data:

Annotations for 1626965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720