FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626967_at:

>probe:Drosophila_2:1626967_at:6:495; Interrogation_Position=3640; Antisense; GTCAAGAGCCGGAAATTTACTAGTA
>probe:Drosophila_2:1626967_at:359:509; Interrogation_Position=3671; Antisense; GTGCATTATTACCTTACAATCGCTA
>probe:Drosophila_2:1626967_at:720:161; Interrogation_Position=3686; Antisense; ACAATCGCTATGAGACGCTCGGAAA
>probe:Drosophila_2:1626967_at:50:393; Interrogation_Position=3707; Antisense; GAAAGCCATTAGAACGCATCGACAA
>probe:Drosophila_2:1626967_at:81:493; Interrogation_Position=3771; Antisense; GTAACATCGTTAGCTCCGAGCAGTC
>probe:Drosophila_2:1626967_at:395:419; Interrogation_Position=3788; Antisense; GAGCAGTCCACATATTTGCCCAGGT
>probe:Drosophila_2:1626967_at:623:693; Interrogation_Position=3802; Antisense; TTTGCCCAGGTGCTAGAAATAAGTC
>probe:Drosophila_2:1626967_at:354:661; Interrogation_Position=3876; Antisense; TAACGCGAAGCGAACAAGCCAACCA
>probe:Drosophila_2:1626967_at:635:117; Interrogation_Position=3892; Antisense; AGCCAACCAACTCATCGAATATTTA
>probe:Drosophila_2:1626967_at:460:15; Interrogation_Position=4031; Antisense; ATTAGGCACCCTCTATGTCAAAATA
>probe:Drosophila_2:1626967_at:284:653; Interrogation_Position=4076; Antisense; TAACCAATCGGGTTTAGAGGCTCTT
>probe:Drosophila_2:1626967_at:33:437; Interrogation_Position=4092; Antisense; GAGGCTCTTTTTGTTGGATGCTTTT
>probe:Drosophila_2:1626967_at:322:475; Interrogation_Position=4150; Antisense; GTTACTCTTGTATGCAATTGTTACT
>probe:Drosophila_2:1626967_at:536:725; Interrogation_Position=4184; Antisense; TTGTTGTCCGACTTTTTGTATGCAT

Paste this into a BLAST search page for me
GTCAAGAGCCGGAAATTTACTAGTAGTGCATTATTACCTTACAATCGCTAACAATCGCTATGAGACGCTCGGAAAGAAAGCCATTAGAACGCATCGACAAGTAACATCGTTAGCTCCGAGCAGTCGAGCAGTCCACATATTTGCCCAGGTTTTGCCCAGGTGCTAGAAATAAGTCTAACGCGAAGCGAACAAGCCAACCAAGCCAACCAACTCATCGAATATTTAATTAGGCACCCTCTATGTCAAAATATAACCAATCGGGTTTAGAGGCTCTTGAGGCTCTTTTTGTTGGATGCTTTTGTTACTCTTGTATGCAATTGTTACTTTGTTGTCCGACTTTTTGTATGCAT

Full Affymetrix probeset data:

Annotations for 1626967_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720