FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626969_at:

>probe:Drosophila_2:1626969_at:489:441; Interrogation_Position=150; Antisense; GATGGACATCTGTAACGCGTTCAAC
>probe:Drosophila_2:1626969_at:381:653; Interrogation_Position=170; Antisense; TCAACGCGGTTGACTGGGCAAGGAC
>probe:Drosophila_2:1626969_at:490:405; Interrogation_Position=192; Antisense; GACGCTGGAGTCACTAAGGGCCTTT
>probe:Drosophila_2:1626969_at:227:699; Interrogation_Position=214; Antisense; TTTAAAGGCATCTACCTCAGCACTC
>probe:Drosophila_2:1626969_at:157:113; Interrogation_Position=232; Antisense; AGCACTCGCGTGCTTGTCATCGAAT
>probe:Drosophila_2:1626969_at:6:45; Interrogation_Position=250; Antisense; ATCGAATCGTCATTGGGCTCCAGAG
>probe:Drosophila_2:1626969_at:389:495; Interrogation_Position=277; Antisense; GTCACGGGACCGATGTTCTGGAACA
>probe:Drosophila_2:1626969_at:728:23; Interrogation_Position=311; Antisense; ATAGTGTTCTAAGCCTTGCTCTTCC
>probe:Drosophila_2:1626969_at:546:357; Interrogation_Position=341; Antisense; GCACAAAGATCGTGGGCCTCGCAAA
>probe:Drosophila_2:1626969_at:305:375; Interrogation_Position=385; Antisense; GAAGCATGTCTAGCTGTGGCCGGCC
>probe:Drosophila_2:1626969_at:128:179; Interrogation_Position=426; Antisense; AAAAACGGTAGCTGTCCTCATCTCG
>probe:Drosophila_2:1626969_at:100:439; Interrogation_Position=466; Antisense; GAGGCAGCACGCATCCAAGTTGGGA
>probe:Drosophila_2:1626969_at:366:137; Interrogation_Position=70; Antisense; ACGGTTACCAACACTGCTGCCAGAG
>probe:Drosophila_2:1626969_at:227:309; Interrogation_Position=89; Antisense; CCAGAGCCATTTCAGGTTCCAAGTG

Paste this into a BLAST search page for me
GATGGACATCTGTAACGCGTTCAACTCAACGCGGTTGACTGGGCAAGGACGACGCTGGAGTCACTAAGGGCCTTTTTTAAAGGCATCTACCTCAGCACTCAGCACTCGCGTGCTTGTCATCGAATATCGAATCGTCATTGGGCTCCAGAGGTCACGGGACCGATGTTCTGGAACAATAGTGTTCTAAGCCTTGCTCTTCCGCACAAAGATCGTGGGCCTCGCAAAGAAGCATGTCTAGCTGTGGCCGGCCAAAAACGGTAGCTGTCCTCATCTCGGAGGCAGCACGCATCCAAGTTGGGAACGGTTACCAACACTGCTGCCAGAGCCAGAGCCATTTCAGGTTCCAAGTG

Full Affymetrix probeset data:

Annotations for 1626969_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720