FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626970_at:

>probe:Drosophila_2:1626970_at:551:43; Interrogation_Position=1093; Antisense; ATCCCAAGGTCAAGCTCTTTATCAC
>probe:Drosophila_2:1626970_at:228:141; Interrogation_Position=1120; Antisense; ACGGCGGATTGTTGAGCACCATCGA
>probe:Drosophila_2:1626970_at:5:13; Interrogation_Position=1149; Antisense; ATTCATCATGGCAAACCGGTCTTGG
>probe:Drosophila_2:1626970_at:363:625; Interrogation_Position=1177; Antisense; TGCCCTTCTTTTACGATCAATTCCT
>probe:Drosophila_2:1626970_at:193:543; Interrogation_Position=1233; Antisense; GGATTGGGACTCGATCACACGACAA
>probe:Drosophila_2:1626970_at:564:251; Interrogation_Position=1298; Antisense; CAAGGAGCCGAGATTTGCGCAGATT
>probe:Drosophila_2:1626970_at:532:513; Interrogation_Position=1348; Antisense; GTGATCAGCCAATGAGTCCACTGGA
>probe:Drosophila_2:1626970_at:187:557; Interrogation_Position=1370; Antisense; GGACACCGCCATTTGGTGGACGGAA
>probe:Drosophila_2:1626970_at:563:407; Interrogation_Position=1388; Antisense; GACGGAATACGTTCTGCGGCACAAA
>probe:Drosophila_2:1626970_at:562:311; Interrogation_Position=1438; Antisense; GCCAGGATTTGGGTTTCTTCGCCTA
>probe:Drosophila_2:1626970_at:247:157; Interrogation_Position=1465; Antisense; ACAGCCTGGATGTCATTGGAGTCCT
>probe:Drosophila_2:1626970_at:385:553; Interrogation_Position=1497; Antisense; GGAGCTCTTCTACTTGTTGCGATCA
>probe:Drosophila_2:1626970_at:646:469; Interrogation_Position=1512; Antisense; GTTGCGATCATTGTGGGAGTCCTTG
>probe:Drosophila_2:1626970_at:153:543; Interrogation_Position=1527; Antisense; GGAGTCCTTGGCAAGCTTACGGATT

Paste this into a BLAST search page for me
ATCCCAAGGTCAAGCTCTTTATCACACGGCGGATTGTTGAGCACCATCGAATTCATCATGGCAAACCGGTCTTGGTGCCCTTCTTTTACGATCAATTCCTGGATTGGGACTCGATCACACGACAACAAGGAGCCGAGATTTGCGCAGATTGTGATCAGCCAATGAGTCCACTGGAGGACACCGCCATTTGGTGGACGGAAGACGGAATACGTTCTGCGGCACAAAGCCAGGATTTGGGTTTCTTCGCCTAACAGCCTGGATGTCATTGGAGTCCTGGAGCTCTTCTACTTGTTGCGATCAGTTGCGATCATTGTGGGAGTCCTTGGGAGTCCTTGGCAAGCTTACGGATT

Full Affymetrix probeset data:

Annotations for 1626970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720