FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626972_at:

>probe:Drosophila_2:1626972_at:519:685; Interrogation_Position=2639; Antisense; TATCACTTGTTTAACGCCAGACCTC
>probe:Drosophila_2:1626972_at:155:155; Interrogation_Position=2651; Antisense; AACGCCAGACCTCTACTAACAAAAT
>probe:Drosophila_2:1626972_at:197:371; Interrogation_Position=2707; Antisense; GAAGGCCAGCAATCTTAATCCATTA
>probe:Drosophila_2:1626972_at:718:105; Interrogation_Position=2765; Antisense; AGAAAAAGCTGCATTTGTCGCCCCA
>probe:Drosophila_2:1626972_at:345:273; Interrogation_Position=2776; Antisense; CATTTGTCGCCCCAGGAATTTTTGC
>probe:Drosophila_2:1626972_at:502:565; Interrogation_Position=2790; Antisense; GGAATTTTTGCGAAATCATCCCATC
>probe:Drosophila_2:1626972_at:78:37; Interrogation_Position=2804; Antisense; ATCATCCCATCTTCCTATTAAACAT
>probe:Drosophila_2:1626972_at:402:703; Interrogation_Position=2909; Antisense; TTATAAGCACGAACTGTAACACGAT
>probe:Drosophila_2:1626972_at:37:345; Interrogation_Position=2940; Antisense; GCATTGCAAACCCATTTTTTAGACA
>probe:Drosophila_2:1626972_at:298:91; Interrogation_Position=2964; Antisense; AGTAGCATCAATCGAATCCGCCAGC
>probe:Drosophila_2:1626972_at:318:363; Interrogation_Position=2977; Antisense; GAATCCGCCAGCAGGTTTTAACCTT
>probe:Drosophila_2:1626972_at:247:565; Interrogation_Position=3049; Antisense; GGAATCAGTTGCACTACTCAGCACA
>probe:Drosophila_2:1626972_at:127:421; Interrogation_Position=3129; Antisense; GAGCAGAACATTTTCGATCCCACGG
>probe:Drosophila_2:1626972_at:500:449; Interrogation_Position=3144; Antisense; GATCCCACGGCAACCTGTGAATGTA

Paste this into a BLAST search page for me
TATCACTTGTTTAACGCCAGACCTCAACGCCAGACCTCTACTAACAAAATGAAGGCCAGCAATCTTAATCCATTAAGAAAAAGCTGCATTTGTCGCCCCACATTTGTCGCCCCAGGAATTTTTGCGGAATTTTTGCGAAATCATCCCATCATCATCCCATCTTCCTATTAAACATTTATAAGCACGAACTGTAACACGATGCATTGCAAACCCATTTTTTAGACAAGTAGCATCAATCGAATCCGCCAGCGAATCCGCCAGCAGGTTTTAACCTTGGAATCAGTTGCACTACTCAGCACAGAGCAGAACATTTTCGATCCCACGGGATCCCACGGCAACCTGTGAATGTA

Full Affymetrix probeset data:

Annotations for 1626972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720