FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626977_at:

>probe:Drosophila_2:1626977_at:372:263; Interrogation_Position=223; Antisense; CAGCGGCAGCGTCAATTACTGTTCT
>probe:Drosophila_2:1626977_at:2:333; Interrogation_Position=225; Antisense; GCGGCAGCGTCAATTACTGTTCTCA
>probe:Drosophila_2:1626977_at:422:567; Interrogation_Position=227; Antisense; GGCAGCGTCAATTACTGTTCTCATA
>probe:Drosophila_2:1626977_at:193:329; Interrogation_Position=231; Antisense; GCGTCAATTACTGTTCTCATATCAT
>probe:Drosophila_2:1626977_at:93:15; Interrogation_Position=237; Antisense; ATTACTGTTCTCATATCATCTCCGA
>probe:Drosophila_2:1626977_at:528:669; Interrogation_Position=239; Antisense; TACTGTTCTCATATCATCTCCGAGA
>probe:Drosophila_2:1626977_at:221:285; Interrogation_Position=241; Antisense; CTGTTCTCATATCATCTCCGAGAGC
>probe:Drosophila_2:1626977_at:675:471; Interrogation_Position=243; Antisense; GTTCTCATATCATCTCCGAGAGCAC
>probe:Drosophila_2:1626977_at:442:643; Interrogation_Position=245; Antisense; TCTCATATCATCTCCGAGAGCACGG
>probe:Drosophila_2:1626977_at:370:23; Interrogation_Position=249; Antisense; ATATCATCTCCGAGAGCACGGAAAT
>probe:Drosophila_2:1626977_at:521:35; Interrogation_Position=254; Antisense; ATCTCCGAGAGCACGGAAATCAGTG
>probe:Drosophila_2:1626977_at:616:101; Interrogation_Position=261; Antisense; AGAGCACGGAAATCAGTGATGGCAA
>probe:Drosophila_2:1626977_at:98:35; Interrogation_Position=272; Antisense; ATCAGTGATGGCAAAGAACGCGAGT
>probe:Drosophila_2:1626977_at:623:511; Interrogation_Position=276; Antisense; GTGATGGCAAAGAACGCGAGTAAAT

Paste this into a BLAST search page for me
CAGCGGCAGCGTCAATTACTGTTCTGCGGCAGCGTCAATTACTGTTCTCAGGCAGCGTCAATTACTGTTCTCATAGCGTCAATTACTGTTCTCATATCATATTACTGTTCTCATATCATCTCCGATACTGTTCTCATATCATCTCCGAGACTGTTCTCATATCATCTCCGAGAGCGTTCTCATATCATCTCCGAGAGCACTCTCATATCATCTCCGAGAGCACGGATATCATCTCCGAGAGCACGGAAATATCTCCGAGAGCACGGAAATCAGTGAGAGCACGGAAATCAGTGATGGCAAATCAGTGATGGCAAAGAACGCGAGTGTGATGGCAAAGAACGCGAGTAAAT

Full Affymetrix probeset data:

Annotations for 1626977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720