FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626978_at:

>probe:Drosophila_2:1626978_at:550:223; Interrogation_Position=1015; Antisense; AAGGATAACTTTGCGGAGCTGGAAA
>probe:Drosophila_2:1626978_at:202:219; Interrogation_Position=1038; Antisense; AAGTCAGTTTATAAGCTCCCTGCAG
>probe:Drosophila_2:1626978_at:288:123; Interrogation_Position=1061; Antisense; AGCCGGGCTGGGAGTTTATCAAACA
>probe:Drosophila_2:1626978_at:230:163; Interrogation_Position=1085; Antisense; AAATTCCGGAAGTCACGTGCAGCAA
>probe:Drosophila_2:1626978_at:559:349; Interrogation_Position=1103; Antisense; GCAGCAAAATTTTACCCAGCTTGGT
>probe:Drosophila_2:1626978_at:16:405; Interrogation_Position=1140; Antisense; GACTATTCAACTGCATCCGGATGGT
>probe:Drosophila_2:1626978_at:375:109; Interrogation_Position=1175; Antisense; AGAAGTTTTACTCCATCGATGGCGA
>probe:Drosophila_2:1626978_at:587:435; Interrogation_Position=1198; Antisense; GAGGAGTACGATGCAAGACCCATTA
>probe:Drosophila_2:1626978_at:579:79; Interrogation_Position=1223; Antisense; AGGTATCTGTTGTTCCCAATGCTAT
>probe:Drosophila_2:1626978_at:520:305; Interrogation_Position=764; Antisense; CCTTTGCCGATAACTGGAGCCTTAA
>probe:Drosophila_2:1626978_at:638:553; Interrogation_Position=779; Antisense; GGAGCCTTAAGACCGACTATGTGTA
>probe:Drosophila_2:1626978_at:9:583; Interrogation_Position=819; Antisense; TGGCTGCGTTGACTGTGCTGCTACT
>probe:Drosophila_2:1626978_at:405:129; Interrogation_Position=883; Antisense; ACCAGAGGCCTCATTAAGTACAAGA
>probe:Drosophila_2:1626978_at:489:439; Interrogation_Position=927; Antisense; GAGGCCGCTCGTCAAGAACGACAAT

Paste this into a BLAST search page for me
AAGGATAACTTTGCGGAGCTGGAAAAAGTCAGTTTATAAGCTCCCTGCAGAGCCGGGCTGGGAGTTTATCAAACAAAATTCCGGAAGTCACGTGCAGCAAGCAGCAAAATTTTACCCAGCTTGGTGACTATTCAACTGCATCCGGATGGTAGAAGTTTTACTCCATCGATGGCGAGAGGAGTACGATGCAAGACCCATTAAGGTATCTGTTGTTCCCAATGCTATCCTTTGCCGATAACTGGAGCCTTAAGGAGCCTTAAGACCGACTATGTGTATGGCTGCGTTGACTGTGCTGCTACTACCAGAGGCCTCATTAAGTACAAGAGAGGCCGCTCGTCAAGAACGACAAT

Full Affymetrix probeset data:

Annotations for 1626978_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720