FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626979_at:

>probe:Drosophila_2:1626979_at:75:23; Interrogation_Position=457; Antisense; ATATCCTTCGCCCATGAGCAAACAT
>probe:Drosophila_2:1626979_at:556:15; Interrogation_Position=507; Antisense; ATTTTCTTGGCGTTTCTTAATCGAT
>probe:Drosophila_2:1626979_at:31:465; Interrogation_Position=529; Antisense; GATTGGTGGTGCGACTTTTACCTAG
>probe:Drosophila_2:1626979_at:152:701; Interrogation_Position=544; Antisense; TTTTACCTAGTCAGTGCCACCAATA
>probe:Drosophila_2:1626979_at:559:689; Interrogation_Position=569; Antisense; TATTCATCCACATCAATTCCATCGG
>probe:Drosophila_2:1626979_at:546:41; Interrogation_Position=589; Antisense; ATCGGCTATCTGAGTCTGGGTGTTC
>probe:Drosophila_2:1626979_at:480:591; Interrogation_Position=605; Antisense; TGGGTGTTCTTTATTCCGAGCTCAA
>probe:Drosophila_2:1626979_at:330:159; Interrogation_Position=773; Antisense; ACAAGCTATTTGTTCCTCTCCTTTT
>probe:Drosophila_2:1626979_at:674:641; Interrogation_Position=789; Antisense; TCTCCTTTTCCTGGCATTGATTTAC
>probe:Drosophila_2:1626979_at:63:541; Interrogation_Position=816; Antisense; GGTTTTACTAATTGCCTTGATTGGC
>probe:Drosophila_2:1626979_at:360:187; Interrogation_Position=899; Antisense; AACACGTATTGGATCTTTTTCTGGT
>probe:Drosophila_2:1626979_at:248:697; Interrogation_Position=914; Antisense; TTTTTCTGGTAACTGTCTCCGTTGA
>probe:Drosophila_2:1626979_at:249:1; Interrogation_Position=931; Antisense; TCCGTTGAGGGAGCGGTTAACCAAT
>probe:Drosophila_2:1626979_at:592:727; Interrogation_Position=977; Antisense; TTGGAAATGTCGGTGATCTCAGTAA

Paste this into a BLAST search page for me
ATATCCTTCGCCCATGAGCAAACATATTTTCTTGGCGTTTCTTAATCGATGATTGGTGGTGCGACTTTTACCTAGTTTTACCTAGTCAGTGCCACCAATATATTCATCCACATCAATTCCATCGGATCGGCTATCTGAGTCTGGGTGTTCTGGGTGTTCTTTATTCCGAGCTCAAACAAGCTATTTGTTCCTCTCCTTTTTCTCCTTTTCCTGGCATTGATTTACGGTTTTACTAATTGCCTTGATTGGCAACACGTATTGGATCTTTTTCTGGTTTTTTCTGGTAACTGTCTCCGTTGATCCGTTGAGGGAGCGGTTAACCAATTTGGAAATGTCGGTGATCTCAGTAA

Full Affymetrix probeset data:

Annotations for 1626979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720