FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626980_at:

>probe:Drosophila_2:1626980_at:515:383; Interrogation_Position=2429; Antisense; GAACGGGCAACCAAACCATGAGCAG
>probe:Drosophila_2:1626980_at:718:357; Interrogation_Position=2453; Antisense; GCAACATCATTTACGTATTTCTCAC
>probe:Drosophila_2:1626980_at:552:481; Interrogation_Position=2467; Antisense; GTATTTCTCACCAAATCTAGAGCTT
>probe:Drosophila_2:1626980_at:205:103; Interrogation_Position=2485; Antisense; AGAGCTTACATTTAGATCGTTTAGT
>probe:Drosophila_2:1626980_at:432:43; Interrogation_Position=2500; Antisense; ATCGTTTAGTGATCGAGGAGAACCT
>probe:Drosophila_2:1626980_at:277:435; Interrogation_Position=2514; Antisense; GAGGAGAACCTAACACAATTATAAA
>probe:Drosophila_2:1626980_at:100:265; Interrogation_Position=2640; Antisense; CAGTTTCGAAACTCTGTCAACAAAT
>probe:Drosophila_2:1626980_at:25:353; Interrogation_Position=2710; Antisense; GCAGCATACAAACGGCTAGATCTAT
>probe:Drosophila_2:1626980_at:161:679; Interrogation_Position=2736; Antisense; TAGGTTTAAATATATCTGCAGCGAT
>probe:Drosophila_2:1626980_at:244:39; Interrogation_Position=2749; Antisense; ATCTGCAGCGATCTATGTATGTTGA
>probe:Drosophila_2:1626980_at:52:459; Interrogation_Position=2772; Antisense; GATATTCATTTTCTGCCCAAATCGC
>probe:Drosophila_2:1626980_at:45:323; Interrogation_Position=2786; Antisense; GCCCAAATCGCATTATACATTACTA
>probe:Drosophila_2:1626980_at:11:515; Interrogation_Position=2889; Antisense; GTGTTCATTCAATTTTGCGTTGCGG
>probe:Drosophila_2:1626980_at:637:713; Interrogation_Position=2903; Antisense; TTGCGTTGCGGTGTGTTAACAAATC

Paste this into a BLAST search page for me
GAACGGGCAACCAAACCATGAGCAGGCAACATCATTTACGTATTTCTCACGTATTTCTCACCAAATCTAGAGCTTAGAGCTTACATTTAGATCGTTTAGTATCGTTTAGTGATCGAGGAGAACCTGAGGAGAACCTAACACAATTATAAACAGTTTCGAAACTCTGTCAACAAATGCAGCATACAAACGGCTAGATCTATTAGGTTTAAATATATCTGCAGCGATATCTGCAGCGATCTATGTATGTTGAGATATTCATTTTCTGCCCAAATCGCGCCCAAATCGCATTATACATTACTAGTGTTCATTCAATTTTGCGTTGCGGTTGCGTTGCGGTGTGTTAACAAATC

Full Affymetrix probeset data:

Annotations for 1626980_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720