Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626981_s_at:

>probe:Drosophila_2:1626981_s_at:197:507; Interrogation_Position=594; Antisense; GTGCCTCAGAGATTGTTGAACGCTA
>probe:Drosophila_2:1626981_s_at:370:199; Interrogation_Position=612; Antisense; AACGCTACCGTAGGGAGCTTCTAGA
>probe:Drosophila_2:1626981_s_at:486:553; Interrogation_Position=625; Antisense; GGAGCTTCTAGACCCTGTATTCACG
>probe:Drosophila_2:1626981_s_at:552:601; Interrogation_Position=640; Antisense; TGTATTCACGGGAAACTCGCGCGAA
>probe:Drosophila_2:1626981_s_at:241:373; Interrogation_Position=662; Antisense; GAAGTTACCACGCAGACGACCAACT
>probe:Drosophila_2:1626981_s_at:723:3; Interrogation_Position=698; Antisense; ATTGGATCGGATCCAGATCCCTTGC
>probe:Drosophila_2:1626981_s_at:47:415; Interrogation_Position=731; Antisense; GAGCCAAGGCGTGGCGGATCCTTCA
>probe:Drosophila_2:1626981_s_at:224:449; Interrogation_Position=747; Antisense; GATCCTTCATTCCAAGTGCATTCGA
>probe:Drosophila_2:1626981_s_at:689:689; Interrogation_Position=782; Antisense; TTTGGATTTCCGGACGTTGGACGCG
>probe:Drosophila_2:1626981_s_at:682:543; Interrogation_Position=808; Antisense; GGATCTCGATCCACTGGGTCGCGGT
>probe:Drosophila_2:1626981_s_at:254:503; Interrogation_Position=825; Antisense; GTCGCGGTGGTCATGGTAACCTGTT
>probe:Drosophila_2:1626981_s_at:676:589; Interrogation_Position=838; Antisense; TGGTAACCTGTTCAGCTTTCCATCA
>probe:Drosophila_2:1626981_s_at:712:645; Interrogation_Position=955; Antisense; TCATATGCGCCCACCAGATTGGAAT
>probe:Drosophila_2:1626981_s_at:679:465; Interrogation_Position=971; Antisense; GATTGGAATCCCGATTACTACATGT

Paste this into a BLAST search page for me
GTGCCTCAGAGATTGTTGAACGCTAAACGCTACCGTAGGGAGCTTCTAGAGGAGCTTCTAGACCCTGTATTCACGTGTATTCACGGGAAACTCGCGCGAAGAAGTTACCACGCAGACGACCAACTATTGGATCGGATCCAGATCCCTTGCGAGCCAAGGCGTGGCGGATCCTTCAGATCCTTCATTCCAAGTGCATTCGATTTGGATTTCCGGACGTTGGACGCGGGATCTCGATCCACTGGGTCGCGGTGTCGCGGTGGTCATGGTAACCTGTTTGGTAACCTGTTCAGCTTTCCATCATCATATGCGCCCACCAGATTGGAATGATTGGAATCCCGATTACTACATGT

Full Affymetrix probeset data:

Annotations for 1626981_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime