FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626984_at:

>probe:Drosophila_2:1626984_at:577:655; Interrogation_Position=2341; Antisense; TAATCCGATCCTATTATGAAGGTTT
>probe:Drosophila_2:1626984_at:652:47; Interrogation_Position=2356; Antisense; ATGAAGGTTTCTCACTCTAGGCACA
>probe:Drosophila_2:1626984_at:57:133; Interrogation_Position=2380; Antisense; ACCGCGTTGCGCAATTTCCATTAAA
>probe:Drosophila_2:1626984_at:179:705; Interrogation_Position=2406; Antisense; TTATCTATAAGTTAACAGGCTCCCT
>probe:Drosophila_2:1626984_at:81:279; Interrogation_Position=2440; Antisense; CTACTGTTACCCACTGAATATGCCG
>probe:Drosophila_2:1626984_at:417:363; Interrogation_Position=2455; Antisense; GAATATGCCGTCAAACTTCTTGAAC
>probe:Drosophila_2:1626984_at:482:713; Interrogation_Position=2471; Antisense; TTCTTGAACAGCACACTCAGCTCAA
>probe:Drosophila_2:1626984_at:40:681; Interrogation_Position=2557; Antisense; TATGTGAATTCACCCTAAGAAGTTG
>probe:Drosophila_2:1626984_at:514:417; Interrogation_Position=2681; Antisense; GAGCTTTATGTTGACCAATCCCTAC
>probe:Drosophila_2:1626984_at:439:411; Interrogation_Position=2693; Antisense; GACCAATCCCTACACTTAAACTATA
>probe:Drosophila_2:1626984_at:332:25; Interrogation_Position=2715; Antisense; ATAGATTTCGACCTACTGGACATGT
>probe:Drosophila_2:1626984_at:34:655; Interrogation_Position=2771; Antisense; TAATTCGTGTTACCCATTGACAATG
>probe:Drosophila_2:1626984_at:81:443; Interrogation_Position=2838; Antisense; GATGTCCTATATTTCTGTATACGCG
>probe:Drosophila_2:1626984_at:520:715; Interrogation_Position=2850; Antisense; TTCTGTATACGCGAATATTGCATGT

Paste this into a BLAST search page for me
TAATCCGATCCTATTATGAAGGTTTATGAAGGTTTCTCACTCTAGGCACAACCGCGTTGCGCAATTTCCATTAAATTATCTATAAGTTAACAGGCTCCCTCTACTGTTACCCACTGAATATGCCGGAATATGCCGTCAAACTTCTTGAACTTCTTGAACAGCACACTCAGCTCAATATGTGAATTCACCCTAAGAAGTTGGAGCTTTATGTTGACCAATCCCTACGACCAATCCCTACACTTAAACTATAATAGATTTCGACCTACTGGACATGTTAATTCGTGTTACCCATTGACAATGGATGTCCTATATTTCTGTATACGCGTTCTGTATACGCGAATATTGCATGT

Full Affymetrix probeset data:

Annotations for 1626984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720