FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626986_at:

>probe:Drosophila_2:1626986_at:537:101; Interrogation_Position=219; Antisense; AGAGATCCGCAAAGCAAGCAGCAGA
>probe:Drosophila_2:1626986_at:593:209; Interrogation_Position=234; Antisense; AAGCAGCAGACTTTCCCAATGGCAT
>probe:Drosophila_2:1626986_at:91:633; Interrogation_Position=258; Antisense; TCCGGTGCCAGAAGTGCCTGCAGAT
>probe:Drosophila_2:1626986_at:552:283; Interrogation_Position=275; Antisense; CTGCAGATCGGACACTGGAGCTATG
>probe:Drosophila_2:1626986_at:347:109; Interrogation_Position=309; Antisense; AGAAGCGCAAATACGTCCACCGGAG
>probe:Drosophila_2:1626986_at:568:553; Interrogation_Position=330; Antisense; GGAGCTCGCGTACCAAGCAGCTAAG
>probe:Drosophila_2:1626986_at:716:117; Interrogation_Position=348; Antisense; AGCTAAGCAAGCGTATGTCCCAAAA
>probe:Drosophila_2:1626986_at:617:169; Interrogation_Position=370; Antisense; AAAGGAGGCTGACGCACCCAAGAAC
>probe:Drosophila_2:1626986_at:52:293; Interrogation_Position=489; Antisense; CGTCGGACAGCTCAGACAGCAGCAG
>probe:Drosophila_2:1626986_at:89:629; Interrogation_Position=524; Antisense; TCCTCATCCGAATCAGACTCGAGCA
>probe:Drosophila_2:1626986_at:97:419; Interrogation_Position=544; Antisense; GAGCAGCTCCAGTTCGGATTCGGAC
>probe:Drosophila_2:1626986_at:586:437; Interrogation_Position=572; Antisense; GAGGAAGGCAGCTCGTCAGACTCCA
>probe:Drosophila_2:1626986_at:607:175; Interrogation_Position=662; Antisense; AAACGAGCCGGGAGTTCACCTGAAT
>probe:Drosophila_2:1626986_at:402:473; Interrogation_Position=675; Antisense; GTTCACCTGAATCTTCTGACGATCA

Paste this into a BLAST search page for me
AGAGATCCGCAAAGCAAGCAGCAGAAAGCAGCAGACTTTCCCAATGGCATTCCGGTGCCAGAAGTGCCTGCAGATCTGCAGATCGGACACTGGAGCTATGAGAAGCGCAAATACGTCCACCGGAGGGAGCTCGCGTACCAAGCAGCTAAGAGCTAAGCAAGCGTATGTCCCAAAAAAAGGAGGCTGACGCACCCAAGAACCGTCGGACAGCTCAGACAGCAGCAGTCCTCATCCGAATCAGACTCGAGCAGAGCAGCTCCAGTTCGGATTCGGACGAGGAAGGCAGCTCGTCAGACTCCAAAACGAGCCGGGAGTTCACCTGAATGTTCACCTGAATCTTCTGACGATCA

Full Affymetrix probeset data:

Annotations for 1626986_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720