FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626987_at:

>probe:Drosophila_2:1626987_at:168:691; Interrogation_Position=112; Antisense; TATTCGCCCGATAAGTTGCATGCCA
>probe:Drosophila_2:1626987_at:718:657; Interrogation_Position=123; Antisense; TAAGTTGCATGCCAGCTTGACGCGC
>probe:Drosophila_2:1626987_at:326:69; Interrogation_Position=13; Antisense; ATGGCCAGCATATCGTTTAAGGGTC
>probe:Drosophila_2:1626987_at:457:609; Interrogation_Position=140; Antisense; TGACGCGCAGCGAGAATGCATTGAT
>probe:Drosophila_2:1626987_at:348:219; Interrogation_Position=177; Antisense; AAGTCGCATCGGATGTGTAGCCGTA
>probe:Drosophila_2:1626987_at:712:639; Interrogation_Position=215; Antisense; TCGGTGGTCCGATGATCATTACCTA
>probe:Drosophila_2:1626987_at:470:605; Interrogation_Position=227; Antisense; TGATCATTACCTATCGCGATGCCAT
>probe:Drosophila_2:1626987_at:669:65; Interrogation_Position=254; Antisense; ATGGCATTGTTAAGCTCCGATTTGG
>probe:Drosophila_2:1626987_at:158:685; Interrogation_Position=282; Antisense; TATCGAGGGATATCTTCGCGTATCG
>probe:Drosophila_2:1626987_at:601:653; Interrogation_Position=30; Antisense; TAAGGGTCGACCCACCCAGGTGTTG
>probe:Drosophila_2:1626987_at:62:533; Interrogation_Position=48; Antisense; GGTGTTGCACACCTATCAAGTTTGG
>probe:Drosophila_2:1626987_at:65:357; Interrogation_Position=54; Antisense; GCACACCTATCAAGTTTGGCGCATT
>probe:Drosophila_2:1626987_at:124:729; Interrogation_Position=69; Antisense; TTGGCGCATTGGCAGCGATGAAAAC
>probe:Drosophila_2:1626987_at:419:431; Interrogation_Position=99; Antisense; GAGTCTTGACTATTATTCGCCCGAT

Paste this into a BLAST search page for me
TATTCGCCCGATAAGTTGCATGCCATAAGTTGCATGCCAGCTTGACGCGCATGGCCAGCATATCGTTTAAGGGTCTGACGCGCAGCGAGAATGCATTGATAAGTCGCATCGGATGTGTAGCCGTATCGGTGGTCCGATGATCATTACCTATGATCATTACCTATCGCGATGCCATATGGCATTGTTAAGCTCCGATTTGGTATCGAGGGATATCTTCGCGTATCGTAAGGGTCGACCCACCCAGGTGTTGGGTGTTGCACACCTATCAAGTTTGGGCACACCTATCAAGTTTGGCGCATTTTGGCGCATTGGCAGCGATGAAAACGAGTCTTGACTATTATTCGCCCGAT

Full Affymetrix probeset data:

Annotations for 1626987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720