Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626988_at:

>probe:Drosophila_2:1626988_at:573:437; Interrogation_Position=1284; Antisense; GAGGAGCTCCACGAAATGACGCACG
>probe:Drosophila_2:1626988_at:572:167; Interrogation_Position=1297; Antisense; AAATGACGCACGGATCTGCCTCATC
>probe:Drosophila_2:1626988_at:674:631; Interrogation_Position=1322; Antisense; TCCGGCGACGCCAAATGTTAGTCTA
>probe:Drosophila_2:1626988_at:102:679; Interrogation_Position=1340; Antisense; TAGTCTATCCTTCGCATTTGTTGTT
>probe:Drosophila_2:1626988_at:565:19; Interrogation_Position=1355; Antisense; ATTTGTTGTTTTTGTAGCTGTGTCC
>probe:Drosophila_2:1626988_at:285:599; Interrogation_Position=1367; Antisense; TGTAGCTGTGTCCTATACTCAACTT
>probe:Drosophila_2:1626988_at:566:145; Interrogation_Position=1383; Antisense; ACTCAACTTTGATTTCGCTTCTTTT
>probe:Drosophila_2:1626988_at:240:147; Interrogation_Position=1426; Antisense; ACTAGAGCAATGGTAGCGCCGTCAT
>probe:Drosophila_2:1626988_at:539:317; Interrogation_Position=1443; Antisense; GCCGTCATGACGTCACTTAGTTGTG
>probe:Drosophila_2:1626988_at:151:385; Interrogation_Position=1467; Antisense; GAACTTTTAAATCTCTTTGCATGCT
>probe:Drosophila_2:1626988_at:343:209; Interrogation_Position=1615; Antisense; AAGCAATTCTCAAGTGATCCATGGA
>probe:Drosophila_2:1626988_at:582:395; Interrogation_Position=1638; Antisense; GAAATAATGCAGCTTCCGAGTATAT
>probe:Drosophila_2:1626988_at:302:179; Interrogation_Position=1764; Antisense; AAAACTATTACCTCTCGACGTGACT
>probe:Drosophila_2:1626988_at:319:405; Interrogation_Position=1780; Antisense; GACGTGACTAATCTTTTTTGTTACT

Paste this into a BLAST search page for me
GAGGAGCTCCACGAAATGACGCACGAAATGACGCACGGATCTGCCTCATCTCCGGCGACGCCAAATGTTAGTCTATAGTCTATCCTTCGCATTTGTTGTTATTTGTTGTTTTTGTAGCTGTGTCCTGTAGCTGTGTCCTATACTCAACTTACTCAACTTTGATTTCGCTTCTTTTACTAGAGCAATGGTAGCGCCGTCATGCCGTCATGACGTCACTTAGTTGTGGAACTTTTAAATCTCTTTGCATGCTAAGCAATTCTCAAGTGATCCATGGAGAAATAATGCAGCTTCCGAGTATATAAAACTATTACCTCTCGACGTGACTGACGTGACTAATCTTTTTTGTTACT

Full Affymetrix probeset data:

Annotations for 1626988_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime