Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626989_at:

>probe:Drosophila_2:1626989_at:598:77; Interrogation_Position=1873; Antisense; AGGATCCCAGGATACGAGGCTTCCC
>probe:Drosophila_2:1626989_at:213:439; Interrogation_Position=1888; Antisense; GAGGCTTCCCTGTACTGCTACGATT
>probe:Drosophila_2:1626989_at:156:599; Interrogation_Position=1903; Antisense; TGCTACGATTTGTGTTTGTGAACCT
>probe:Drosophila_2:1626989_at:243:201; Interrogation_Position=1923; Antisense; AACCTTGGATGGACGGAAGCGACAC
>probe:Drosophila_2:1626989_at:595:399; Interrogation_Position=1943; Antisense; GACACCATCTGGGTGCAACATCGAT
>probe:Drosophila_2:1626989_at:575:253; Interrogation_Position=1958; Antisense; CAACATCGATGTGGTTGCTGCTGCT
>probe:Drosophila_2:1626989_at:612:721; Interrogation_Position=1972; Antisense; TTGCTGCTGCTGTTTTGTCCTCCAG
>probe:Drosophila_2:1626989_at:252:469; Interrogation_Position=2044; Antisense; GTTCCGGTTCCCAAGTGAGATGGCT
>probe:Drosophila_2:1626989_at:467:607; Interrogation_Position=2059; Antisense; TGAGATGGCTACATTCGTGTCCTGC
>probe:Drosophila_2:1626989_at:455:555; Interrogation_Position=2090; Antisense; GGACGACGATCAATCCATCCAGTTG
>probe:Drosophila_2:1626989_at:206:235; Interrogation_Position=2101; Antisense; AATCCATCCAGTTGTGTGCAGCGTC
>probe:Drosophila_2:1626989_at:277:503; Interrogation_Position=2123; Antisense; GTCCCAGCGTTGTGAGCGTGTGATA
>probe:Drosophila_2:1626989_at:528:327; Interrogation_Position=2160; Antisense; GCGTTTAAGCTTGTGCGATATTCGA
>probe:Drosophila_2:1626989_at:22:39; Interrogation_Position=2274; Antisense; ATCTATGTTATGTTGCTTGTTCGCA

Paste this into a BLAST search page for me
AGGATCCCAGGATACGAGGCTTCCCGAGGCTTCCCTGTACTGCTACGATTTGCTACGATTTGTGTTTGTGAACCTAACCTTGGATGGACGGAAGCGACACGACACCATCTGGGTGCAACATCGATCAACATCGATGTGGTTGCTGCTGCTTTGCTGCTGCTGTTTTGTCCTCCAGGTTCCGGTTCCCAAGTGAGATGGCTTGAGATGGCTACATTCGTGTCCTGCGGACGACGATCAATCCATCCAGTTGAATCCATCCAGTTGTGTGCAGCGTCGTCCCAGCGTTGTGAGCGTGTGATAGCGTTTAAGCTTGTGCGATATTCGAATCTATGTTATGTTGCTTGTTCGCA

Full Affymetrix probeset data:

Annotations for 1626989_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime