FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626991_at:

>probe:Drosophila_2:1626991_at:298:165; Interrogation_Position=1016; Antisense; AAATCGGCACGGCTATTATTACACG
>probe:Drosophila_2:1626991_at:539:259; Interrogation_Position=1037; Antisense; CACGACGTGCCTATTTAAACGGCGA
>probe:Drosophila_2:1626991_at:685:653; Interrogation_Position=1052; Antisense; TAAACGGCGATTGGGTGAACTGCAC
>probe:Drosophila_2:1626991_at:711:143; Interrogation_Position=1070; Antisense; ACTGCACAGTGTCTCGCTTAAATAC
>probe:Drosophila_2:1626991_at:523:267; Interrogation_Position=1106; Antisense; CAGGAGGCGCCTTTGTCATAGTAAT
>probe:Drosophila_2:1626991_at:645:253; Interrogation_Position=1167; Antisense; CAACAGGTCCTTGTTTCATTTTAAG
>probe:Drosophila_2:1626991_at:710:55; Interrogation_Position=1198; Antisense; ATGAGGCCAGAGTGCGTCGACATTG
>probe:Drosophila_2:1626991_at:270:547; Interrogation_Position=764; Antisense; GGATGGTTTTATCTTCTCTGGCAAA
>probe:Drosophila_2:1626991_at:223:29; Interrogation_Position=795; Antisense; ATCTAAAAAGTTCCTCTACCAGCCG
>probe:Drosophila_2:1626991_at:555:105; Interrogation_Position=891; Antisense; AGAAGGTCGTGTCCGATTGATGCCC
>probe:Drosophila_2:1626991_at:275:465; Interrogation_Position=905; Antisense; GATTGATGCCCCAAAGATTCAGTAT
>probe:Drosophila_2:1626991_at:489:393; Interrogation_Position=949; Antisense; GAAATTTGGCCGCAACCCACAGTGT
>probe:Drosophila_2:1626991_at:127:155; Interrogation_Position=967; Antisense; ACAGTGTCATTCTATTTCAGCCCAT
>probe:Drosophila_2:1626991_at:618:647; Interrogation_Position=983; Antisense; TCAGCCCATGTTTCTTGCGTAGTAG

Paste this into a BLAST search page for me
AAATCGGCACGGCTATTATTACACGCACGACGTGCCTATTTAAACGGCGATAAACGGCGATTGGGTGAACTGCACACTGCACAGTGTCTCGCTTAAATACCAGGAGGCGCCTTTGTCATAGTAATCAACAGGTCCTTGTTTCATTTTAAGATGAGGCCAGAGTGCGTCGACATTGGGATGGTTTTATCTTCTCTGGCAAAATCTAAAAAGTTCCTCTACCAGCCGAGAAGGTCGTGTCCGATTGATGCCCGATTGATGCCCCAAAGATTCAGTATGAAATTTGGCCGCAACCCACAGTGTACAGTGTCATTCTATTTCAGCCCATTCAGCCCATGTTTCTTGCGTAGTAG

Full Affymetrix probeset data:

Annotations for 1626991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720