Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626993_at:

>probe:Drosophila_2:1626993_at:664:43; Interrogation_Position=4054; Antisense; ATCGCAGATGAATTAGTCCCCAGGA
>probe:Drosophila_2:1626993_at:102:93; Interrogation_Position=4107; Antisense; AGTTTTCTTGGCTATGCTGCCGAAA
>probe:Drosophila_2:1626993_at:710:493; Interrogation_Position=4149; Antisense; GTCAAAGTGGCGGTCTTGGTTCTAT
>probe:Drosophila_2:1626993_at:260:239; Interrogation_Position=4194; Antisense; AATCTCTTTTGGTATGTCGCATTCA
>probe:Drosophila_2:1626993_at:133:503; Interrogation_Position=4209; Antisense; GTCGCATTCAATCTTACAGTACGTT
>probe:Drosophila_2:1626993_at:502:15; Interrogation_Position=4278; Antisense; ATTTTGATTCACTTGCTACGGCATT
>probe:Drosophila_2:1626993_at:477:141; Interrogation_Position=4295; Antisense; ACGGCATTCGATTCAGCTACTCGTA
>probe:Drosophila_2:1626993_at:458:263; Interrogation_Position=4308; Antisense; CAGCTACTCGTACATTATCCCAAAT
>probe:Drosophila_2:1626993_at:599:239; Interrogation_Position=4330; Antisense; AATACTCTATTCTAAGCTCCCTAAG
>probe:Drosophila_2:1626993_at:409:703; Interrogation_Position=4364; Antisense; TTTTGGCCTATGTATTCCTTCGCTA
>probe:Drosophila_2:1626993_at:229:457; Interrogation_Position=4395; Antisense; GATACATTTATGTTCTGCTTCCCGA
>probe:Drosophila_2:1626993_at:264:715; Interrogation_Position=4407; Antisense; TTCTGCTTCCCGATTCGAGAATCAA
>probe:Drosophila_2:1626993_at:526:109; Interrogation_Position=4508; Antisense; AGAAGATGCCGCACATGTATGCCCA
>probe:Drosophila_2:1626993_at:512:379; Interrogation_Position=4545; Antisense; GAAGCCACGACAGCCAACAATTGAG

Paste this into a BLAST search page for me
ATCGCAGATGAATTAGTCCCCAGGAAGTTTTCTTGGCTATGCTGCCGAAAGTCAAAGTGGCGGTCTTGGTTCTATAATCTCTTTTGGTATGTCGCATTCAGTCGCATTCAATCTTACAGTACGTTATTTTGATTCACTTGCTACGGCATTACGGCATTCGATTCAGCTACTCGTACAGCTACTCGTACATTATCCCAAATAATACTCTATTCTAAGCTCCCTAAGTTTTGGCCTATGTATTCCTTCGCTAGATACATTTATGTTCTGCTTCCCGATTCTGCTTCCCGATTCGAGAATCAAAGAAGATGCCGCACATGTATGCCCAGAAGCCACGACAGCCAACAATTGAG

Full Affymetrix probeset data:

Annotations for 1626993_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime