FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626994_at:

>probe:Drosophila_2:1626994_at:533:169; Interrogation_Position=198; Antisense; AAAGATATTGGTCCAGTCCCGCTTG
>probe:Drosophila_2:1626994_at:593:501; Interrogation_Position=213; Antisense; GTCCCGCTTGGAATGTCAAACTTTG
>probe:Drosophila_2:1626994_at:299:545; Interrogation_Position=264; Antisense; GGATCTGCTATAGCTACATTAACTT
>probe:Drosophila_2:1626994_at:689:185; Interrogation_Position=373; Antisense; AACAATTCGATCACTCCTGGTATTA
>probe:Drosophila_2:1626994_at:501:227; Interrogation_Position=418; Antisense; AATGGAGTCCGCACGGATCTAACTC
>probe:Drosophila_2:1626994_at:109:451; Interrogation_Position=433; Antisense; GATCTAACTCGTTGGATGTCGGGTT
>probe:Drosophila_2:1626994_at:325:501; Interrogation_Position=450; Antisense; GTCGGGTTTATGTACTCTGACACAT
>probe:Drosophila_2:1626994_at:255:397; Interrogation_Position=468; Antisense; GACACATTTTTTGGTGCGAAGCACG
>probe:Drosophila_2:1626994_at:64:457; Interrogation_Position=534; Antisense; GATATGGTTACCTGAGTCTTTACCC
>probe:Drosophila_2:1626994_at:95:581; Interrogation_Position=546; Antisense; TGAGTCTTTACCCTTCTTACGTAGA
>probe:Drosophila_2:1626994_at:721:97; Interrogation_Position=585; Antisense; AGAGGTATTATTATCCCCGAGCCAA
>probe:Drosophila_2:1626994_at:704:85; Interrogation_Position=609; Antisense; AGTCCCAAAGGCTTCTTAGCTCGTA
>probe:Drosophila_2:1626994_at:331:509; Interrogation_Position=651; Antisense; GTGCTATATTCCAACACCTTCAGTT
>probe:Drosophila_2:1626994_at:582:153; Interrogation_Position=664; Antisense; ACACCTTCAGTTCAATCACCAATTC

Paste this into a BLAST search page for me
AAAGATATTGGTCCAGTCCCGCTTGGTCCCGCTTGGAATGTCAAACTTTGGGATCTGCTATAGCTACATTAACTTAACAATTCGATCACTCCTGGTATTAAATGGAGTCCGCACGGATCTAACTCGATCTAACTCGTTGGATGTCGGGTTGTCGGGTTTATGTACTCTGACACATGACACATTTTTTGGTGCGAAGCACGGATATGGTTACCTGAGTCTTTACCCTGAGTCTTTACCCTTCTTACGTAGAAGAGGTATTATTATCCCCGAGCCAAAGTCCCAAAGGCTTCTTAGCTCGTAGTGCTATATTCCAACACCTTCAGTTACACCTTCAGTTCAATCACCAATTC

Full Affymetrix probeset data:

Annotations for 1626994_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720