FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626995_at:

>probe:Drosophila_2:1626995_at:518:631; Interrogation_Position=1005; Antisense; TCCCCATGTTAGTGCGCTTTACGAT
>probe:Drosophila_2:1626995_at:633:487; Interrogation_Position=521; Antisense; GTACCAGCAGCGAGAATGTCATCAA
>probe:Drosophila_2:1626995_at:58:163; Interrogation_Position=585; Antisense; AAATTGGTGGCATGTCCTCACCTAC
>probe:Drosophila_2:1626995_at:408:95; Interrogation_Position=710; Antisense; AGATATACAAGTCTGCTGCCCAATA
>probe:Drosophila_2:1626995_at:290:621; Interrogation_Position=723; Antisense; TGCTGCCCAATATTTCCTGAGTACT
>probe:Drosophila_2:1626995_at:691:427; Interrogation_Position=741; Antisense; GAGTACTCCGTATGGGCGTTACGAC
>probe:Drosophila_2:1626995_at:160:519; Interrogation_Position=778; Antisense; GTGGCACCCGAAGATGTTACTTTAT
>probe:Drosophila_2:1626995_at:78:705; Interrogation_Position=794; Antisense; TTACTTTATATGCTGGCCTTTGCGC
>probe:Drosophila_2:1626995_at:435:337; Interrogation_Position=817; Antisense; GCTCTAGCCACTTTCGATCGGGAAA
>probe:Drosophila_2:1626995_at:49:155; Interrogation_Position=846; Antisense; ACAGCTGAACGCTATCAACTCGGAA
>probe:Drosophila_2:1626995_at:606:305; Interrogation_Position=880; Antisense; CCATTCTTTCAGCTTTCGCCAAAAA
>probe:Drosophila_2:1626995_at:38:565; Interrogation_Position=936; Antisense; GGAATTCGATGCCTGTATGACCCTG
>probe:Drosophila_2:1626995_at:170:485; Interrogation_Position=950; Antisense; GTATGACCCTGTTGCGCGAAATCGA
>probe:Drosophila_2:1626995_at:82:333; Interrogation_Position=987; Antisense; GCTGGATGTTTATTTGTCTCCCCAT

Paste this into a BLAST search page for me
TCCCCATGTTAGTGCGCTTTACGATGTACCAGCAGCGAGAATGTCATCAAAAATTGGTGGCATGTCCTCACCTACAGATATACAAGTCTGCTGCCCAATATGCTGCCCAATATTTCCTGAGTACTGAGTACTCCGTATGGGCGTTACGACGTGGCACCCGAAGATGTTACTTTATTTACTTTATATGCTGGCCTTTGCGCGCTCTAGCCACTTTCGATCGGGAAAACAGCTGAACGCTATCAACTCGGAACCATTCTTTCAGCTTTCGCCAAAAAGGAATTCGATGCCTGTATGACCCTGGTATGACCCTGTTGCGCGAAATCGAGCTGGATGTTTATTTGTCTCCCCAT

Full Affymetrix probeset data:

Annotations for 1626995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720