Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626997_at:

>probe:Drosophila_2:1626997_at:276:575; Interrogation_Position=1524; Antisense; GGCGCATGCGACTCGCCATATGTTC
>probe:Drosophila_2:1626997_at:520:59; Interrogation_Position=1543; Antisense; ATGTTCGGCATTATCGGGCCGCGAA
>probe:Drosophila_2:1626997_at:421:129; Interrogation_Position=1587; Antisense; ACCAGTACAGGTGGCAGGACGCAGA
>probe:Drosophila_2:1626997_at:110:153; Interrogation_Position=1615; Antisense; ACAGGTGGATACGACTGGTCGCCGA
>probe:Drosophila_2:1626997_at:378:635; Interrogation_Position=1633; Antisense; TCGCCGACAGGCAGTGAATTGACGT
>probe:Drosophila_2:1626997_at:582:303; Interrogation_Position=1661; Antisense; CCGGTTGAGCTTTCATTCACGGATA
>probe:Drosophila_2:1626997_at:436:205; Interrogation_Position=1688; Antisense; AAGCTCGTTGAGTGCGACAGCGTTT
>probe:Drosophila_2:1626997_at:18:679; Interrogation_Position=1773; Antisense; TAGGTCAGTTGGATTTCTTCGCGTC
>probe:Drosophila_2:1626997_at:526:275; Interrogation_Position=1789; Antisense; CTTCGCGTCTTTGAGTTGCTTGAGA
>probe:Drosophila_2:1626997_at:351:423; Interrogation_Position=1810; Antisense; GAGAAGCAGCTGATAAACCCAACAA
>probe:Drosophila_2:1626997_at:146:475; Interrogation_Position=1854; Antisense; GTTACCTAAGTACGCCAATTCCTCA
>probe:Drosophila_2:1626997_at:426:247; Interrogation_Position=1870; Antisense; AATTCCTCATCATCTTCGATTGTTT
>probe:Drosophila_2:1626997_at:118:343; Interrogation_Position=1967; Antisense; GCTTACATTGTGCTGGTTTTTTATA
>probe:Drosophila_2:1626997_at:623:389; Interrogation_Position=1999; Antisense; GAAACATTCAAGACCCAAGCCTTAA

Paste this into a BLAST search page for me
GGCGCATGCGACTCGCCATATGTTCATGTTCGGCATTATCGGGCCGCGAAACCAGTACAGGTGGCAGGACGCAGAACAGGTGGATACGACTGGTCGCCGATCGCCGACAGGCAGTGAATTGACGTCCGGTTGAGCTTTCATTCACGGATAAAGCTCGTTGAGTGCGACAGCGTTTTAGGTCAGTTGGATTTCTTCGCGTCCTTCGCGTCTTTGAGTTGCTTGAGAGAGAAGCAGCTGATAAACCCAACAAGTTACCTAAGTACGCCAATTCCTCAAATTCCTCATCATCTTCGATTGTTTGCTTACATTGTGCTGGTTTTTTATAGAAACATTCAAGACCCAAGCCTTAA

Full Affymetrix probeset data:

Annotations for 1626997_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime