FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626998_at:

>probe:Drosophila_2:1626998_at:687:149; Interrogation_Position=1033; Antisense; ACTTGAAGACTCACTTCCGCTCTAA
>probe:Drosophila_2:1626998_at:299:301; Interrogation_Position=1120; Antisense; CCCAGTCAGCGGATCAGGTCAAATT
>probe:Drosophila_2:1626998_at:496:69; Interrogation_Position=1171; Antisense; AGGCGGATGCCTTTACGATAGAAGT
>probe:Drosophila_2:1626998_at:699:455; Interrogation_Position=1187; Antisense; GATAGAAGTGCCTTTGCCCGCGGAG
>probe:Drosophila_2:1626998_at:490:335; Interrogation_Position=1239; Antisense; GCTGCTCTGGAAACATCCACTCTAA
>probe:Drosophila_2:1626998_at:631:61; Interrogation_Position=1290; Antisense; AGTCCATCTCAACCTTTAAAGCCAA
>probe:Drosophila_2:1626998_at:654:11; Interrogation_Position=735; Antisense; ATTAGGCCCTTTCAGTGCGAACTCT
>probe:Drosophila_2:1626998_at:452:631; Interrogation_Position=772; Antisense; TCCTGTCCTCCGGTGAGCTGAAAGG
>probe:Drosophila_2:1626998_at:387:427; Interrogation_Position=817; Antisense; GAGATCGCAAGTTCCAGTGTCGTTA
>probe:Drosophila_2:1626998_at:582:665; Interrogation_Position=855; Antisense; TACGTCAACTACAGTGGTCGCCTGC
>probe:Drosophila_2:1626998_at:23:417; Interrogation_Position=885; Antisense; GAGCGGACCCACACAAATGATCGAC
>probe:Drosophila_2:1626998_at:336:59; Interrogation_Position=901; Antisense; ATGATCGACCCTTTATTTGTGCGCA
>probe:Drosophila_2:1626998_at:130:251; Interrogation_Position=932; Antisense; CAAGAGCTTTACCAATTCCTACATC
>probe:Drosophila_2:1626998_at:323:323; Interrogation_Position=989; Antisense; GCGCCTATGTGAGCTGTGCCATCGA

Paste this into a BLAST search page for me
ACTTGAAGACTCACTTCCGCTCTAACCCAGTCAGCGGATCAGGTCAAATTAGGCGGATGCCTTTACGATAGAAGTGATAGAAGTGCCTTTGCCCGCGGAGGCTGCTCTGGAAACATCCACTCTAAAGTCCATCTCAACCTTTAAAGCCAAATTAGGCCCTTTCAGTGCGAACTCTTCCTGTCCTCCGGTGAGCTGAAAGGGAGATCGCAAGTTCCAGTGTCGTTATACGTCAACTACAGTGGTCGCCTGCGAGCGGACCCACACAAATGATCGACATGATCGACCCTTTATTTGTGCGCACAAGAGCTTTACCAATTCCTACATCGCGCCTATGTGAGCTGTGCCATCGA

Full Affymetrix probeset data:

Annotations for 1626998_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720