Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627002_at:

>probe:Drosophila_2:1627002_at:477:511; Interrogation_Position=1405; Antisense; GTGAACAACGTCTTCAATCCCACGG
>probe:Drosophila_2:1627002_at:603:233; Interrogation_Position=1420; Antisense; AATCCCACGGGCGAGTTTTGTCGTG
>probe:Drosophila_2:1627002_at:139:327; Interrogation_Position=1430; Antisense; GCGAGTTTTGTCGTGCGCCAAAGAA
>probe:Drosophila_2:1627002_at:475:7; Interrogation_Position=1457; Antisense; ATTGCTTCAAGCACTACGCCTGGGA
>probe:Drosophila_2:1627002_at:614:111; Interrogation_Position=1466; Antisense; AGCACTACGCCTGGGAGAAGATCCG
>probe:Drosophila_2:1627002_at:234:375; Interrogation_Position=1482; Antisense; GAAGATCCGGCGTGCTGAGATAGAT
>probe:Drosophila_2:1627002_at:421:587; Interrogation_Position=1508; Antisense; TGGAGCGTGTGCGTCAATGGCTCAA
>probe:Drosophila_2:1627002_at:538:249; Interrogation_Position=1522; Antisense; CAATGGCTCAAGATGGACGACCTGA
>probe:Drosophila_2:1627002_at:697:567; Interrogation_Position=1568; Antisense; GGCAGCAGCTCACCTCGCGAGCGAA
>probe:Drosophila_2:1627002_at:681:121; Interrogation_Position=1587; Antisense; AGCGAACCTGCTCGGCCTGATGCTG
>probe:Drosophila_2:1627002_at:662:267; Interrogation_Position=1660; Antisense; CAGGAGCATCTGGTAGAGTTCGAGA
>probe:Drosophila_2:1627002_at:635:143; Interrogation_Position=1887; Antisense; ACTGCAATTGAAGCCACATCATCTG
>probe:Drosophila_2:1627002_at:379:149; Interrogation_Position=1917; Antisense; ACTTCAACTTCAACTGTTGCAGCAG
>probe:Drosophila_2:1627002_at:200:371; Interrogation_Position=1950; Antisense; GAAGGCCCAAATACCACAGAAAACT

Paste this into a BLAST search page for me
GTGAACAACGTCTTCAATCCCACGGAATCCCACGGGCGAGTTTTGTCGTGGCGAGTTTTGTCGTGCGCCAAAGAAATTGCTTCAAGCACTACGCCTGGGAAGCACTACGCCTGGGAGAAGATCCGGAAGATCCGGCGTGCTGAGATAGATTGGAGCGTGTGCGTCAATGGCTCAACAATGGCTCAAGATGGACGACCTGAGGCAGCAGCTCACCTCGCGAGCGAAAGCGAACCTGCTCGGCCTGATGCTGCAGGAGCATCTGGTAGAGTTCGAGAACTGCAATTGAAGCCACATCATCTGACTTCAACTTCAACTGTTGCAGCAGGAAGGCCCAAATACCACAGAAAACT

Full Affymetrix probeset data:

Annotations for 1627002_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime