FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627003_at:

>probe:Drosophila_2:1627003_at:699:665; Interrogation_Position=1029; Antisense; TACTTTGAATGCATGCGGGCGGATT
>probe:Drosophila_2:1627003_at:676:457; Interrogation_Position=1050; Antisense; GATTTTTTAAAATCGCTGCGCCCGA
>probe:Drosophila_2:1627003_at:142:337; Interrogation_Position=1064; Antisense; GCTGCGCCCGACTGAATAACTACAA
>probe:Drosophila_2:1627003_at:40:713; Interrogation_Position=494; Antisense; TTCAACAACGATCCAGACCACATAG
>probe:Drosophila_2:1627003_at:138:655; Interrogation_Position=560; Antisense; TACAGAATTTTTCGTCCCTTCGGCA
>probe:Drosophila_2:1627003_at:149:177; Interrogation_Position=586; Antisense; AAACGCTGTCACCATCGTAACAATA
>probe:Drosophila_2:1627003_at:516:225; Interrogation_Position=623; Antisense; AAGGCGGCTATTGTCTTCAAAGGAG
>probe:Drosophila_2:1627003_at:559:125; Interrogation_Position=684; Antisense; AGCCGCTGGAGCATGACGACCTGTG
>probe:Drosophila_2:1627003_at:312:431; Interrogation_Position=713; Antisense; GAGTCACGTTACGAGGTGTTCCGCA
>probe:Drosophila_2:1627003_at:13:535; Interrogation_Position=727; Antisense; GGTGTTCCGCAAAGTCCAGGATCAT
>probe:Drosophila_2:1627003_at:687:543; Interrogation_Position=745; Antisense; GGATCATGCTCACTCAGCAATGCTG
>probe:Drosophila_2:1627003_at:506:233; Interrogation_Position=763; Antisense; AATGCTGCATTTCTTTTCGCCGACG
>probe:Drosophila_2:1627003_at:509:407; Interrogation_Position=784; Antisense; GACGTTGCCCGATCTGGCAGTGAAA
>probe:Drosophila_2:1627003_at:145:571; Interrogation_Position=822; Antisense; GGCTGAACAGCCACGTCAAACTTTT

Paste this into a BLAST search page for me
TACTTTGAATGCATGCGGGCGGATTGATTTTTTAAAATCGCTGCGCCCGAGCTGCGCCCGACTGAATAACTACAATTCAACAACGATCCAGACCACATAGTACAGAATTTTTCGTCCCTTCGGCAAAACGCTGTCACCATCGTAACAATAAAGGCGGCTATTGTCTTCAAAGGAGAGCCGCTGGAGCATGACGACCTGTGGAGTCACGTTACGAGGTGTTCCGCAGGTGTTCCGCAAAGTCCAGGATCATGGATCATGCTCACTCAGCAATGCTGAATGCTGCATTTCTTTTCGCCGACGGACGTTGCCCGATCTGGCAGTGAAAGGCTGAACAGCCACGTCAAACTTTT

Full Affymetrix probeset data:

Annotations for 1627003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720