FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627004_at:

>probe:Drosophila_2:1627004_at:502:345; Interrogation_Position=1014; Antisense; GCATCTCTTTATCAAGGCCCTGCAG
>probe:Drosophila_2:1627004_at:239:211; Interrogation_Position=1093; Antisense; AAGAATCCTCTGTTCGAATACCACG
>probe:Drosophila_2:1627004_at:24:465; Interrogation_Position=1120; Antisense; GTTGAAGGAACTCACCATGTCCACC
>probe:Drosophila_2:1627004_at:101:63; Interrogation_Position=1136; Antisense; ATGTCCACCTTAACGAGCCAGAGAA
>probe:Drosophila_2:1627004_at:13:109; Interrogation_Position=1157; Antisense; AGAAGGTGGCGCCTATCATCAACTC
>probe:Drosophila_2:1627004_at:666:633; Interrogation_Position=1191; Antisense; TAGGTACCGGCCTTTATGAGACCGC
>probe:Drosophila_2:1627004_at:265:605; Interrogation_Position=1207; Antisense; TGAGACCGCCTTAACATAGACCTCG
>probe:Drosophila_2:1627004_at:275:25; Interrogation_Position=1222; Antisense; ATAGACCTCGACATATAGACCCGTG
>probe:Drosophila_2:1627004_at:354:147; Interrogation_Position=1252; Antisense; ACTAGCGGATTCGTGTACCTTACTC
>probe:Drosophila_2:1627004_at:365:219; Interrogation_Position=844; Antisense; AAGTCCGTCTCAATTGATGCCTGCA
>probe:Drosophila_2:1627004_at:666:561; Interrogation_Position=884; Antisense; GGAACTGCAAACCATCGACGCACGA
>probe:Drosophila_2:1627004_at:420:353; Interrogation_Position=903; Antisense; GCACGAGCCTCACAAGTATTACTTC
>probe:Drosophila_2:1627004_at:226:687; Interrogation_Position=956; Antisense; TATTTTACACGTTGCACCAGGAGGT
>probe:Drosophila_2:1627004_at:286:577; Interrogation_Position=993; Antisense; GGCGCGCAGAATTAAGTGCCCGCAT

Paste this into a BLAST search page for me
GCATCTCTTTATCAAGGCCCTGCAGAAGAATCCTCTGTTCGAATACCACGGTTGAAGGAACTCACCATGTCCACCATGTCCACCTTAACGAGCCAGAGAAAGAAGGTGGCGCCTATCATCAACTCTAGGTACCGGCCTTTATGAGACCGCTGAGACCGCCTTAACATAGACCTCGATAGACCTCGACATATAGACCCGTGACTAGCGGATTCGTGTACCTTACTCAAGTCCGTCTCAATTGATGCCTGCAGGAACTGCAAACCATCGACGCACGAGCACGAGCCTCACAAGTATTACTTCTATTTTACACGTTGCACCAGGAGGTGGCGCGCAGAATTAAGTGCCCGCAT

Full Affymetrix probeset data:

Annotations for 1627004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720