FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627005_at:

>probe:Drosophila_2:1627005_at:209:87; Interrogation_Position=1071; Antisense; AGTCCAGCAGTGAGCTCCCAATGGC
>probe:Drosophila_2:1627005_at:524:355; Interrogation_Position=1100; Antisense; GCACTGACTTCAGAACCGTCCAAAA
>probe:Drosophila_2:1627005_at:356:245; Interrogation_Position=1120; Antisense; CAAAAGATTCCTCACCGGACCTTTG
>probe:Drosophila_2:1627005_at:17:411; Interrogation_Position=1137; Antisense; GACCTTTGGTGATCCGGGTGCGACC
>probe:Drosophila_2:1627005_at:126:161; Interrogation_Position=1185; Antisense; ACAAGATGATGCCACTGCCGCGGGA
>probe:Drosophila_2:1627005_at:684:281; Interrogation_Position=1217; Antisense; CTGCCCTACTTTCATCTTGGTCTGG
>probe:Drosophila_2:1627005_at:651:97; Interrogation_Position=1269; Antisense; AGATCGCCACAATCAGCTCCTTAAA
>probe:Drosophila_2:1627005_at:549:709; Interrogation_Position=1289; Antisense; TTAAAGCAGCAGCACTTCGCCTCTA
>probe:Drosophila_2:1627005_at:276:99; Interrogation_Position=1392; Antisense; AGAGGATCCGCAGGCCTAGACCTAA
>probe:Drosophila_2:1627005_at:356:579; Interrogation_Position=1404; Antisense; GGCCTAGACCTAAGTCCTTGTGTGA
>probe:Drosophila_2:1627005_at:496:551; Interrogation_Position=1447; Antisense; GGAGATCCTGCATCATAGAGTGCGA
>probe:Drosophila_2:1627005_at:130:511; Interrogation_Position=1482; Antisense; GTGAGTCTTCTAGTTGTAGCCGTTT
>probe:Drosophila_2:1627005_at:163:671; Interrogation_Position=1498; Antisense; TAGCCGTTTGAGGAGTTTTCTTGAA
>probe:Drosophila_2:1627005_at:446:15; Interrogation_Position=1579; Antisense; ATTTATTCGCGTGCATTAGTCGTAA

Paste this into a BLAST search page for me
AGTCCAGCAGTGAGCTCCCAATGGCGCACTGACTTCAGAACCGTCCAAAACAAAAGATTCCTCACCGGACCTTTGGACCTTTGGTGATCCGGGTGCGACCACAAGATGATGCCACTGCCGCGGGACTGCCCTACTTTCATCTTGGTCTGGAGATCGCCACAATCAGCTCCTTAAATTAAAGCAGCAGCACTTCGCCTCTAAGAGGATCCGCAGGCCTAGACCTAAGGCCTAGACCTAAGTCCTTGTGTGAGGAGATCCTGCATCATAGAGTGCGAGTGAGTCTTCTAGTTGTAGCCGTTTTAGCCGTTTGAGGAGTTTTCTTGAAATTTATTCGCGTGCATTAGTCGTAA

Full Affymetrix probeset data:

Annotations for 1627005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720