FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627006_at:

>probe:Drosophila_2:1627006_at:302:411; Interrogation_Position=149; Antisense; GACGCAGGGAATCCAGCAGTTGCTC
>probe:Drosophila_2:1627006_at:302:115; Interrogation_Position=163; Antisense; AGCAGTTGCTCGCTGCCGAGAAAAA
>probe:Drosophila_2:1627006_at:87:1; Interrogation_Position=199; Antisense; AGGTCGCCGAGGCTCGTAAACGCAA
>probe:Drosophila_2:1627006_at:581:325; Interrogation_Position=289; Antisense; GCGAGCGCGCCTTCAAGGAGTTCGA
>probe:Drosophila_2:1627006_at:352:543; Interrogation_Position=362; Antisense; GGATATCCGCGTTAAGCTGGCCGAC
>probe:Drosophila_2:1627006_at:405:361; Interrogation_Position=409; Antisense; GCAAGGACCCGTTCATCCTGGAGAT
>probe:Drosophila_2:1627006_at:511:89; Interrogation_Position=439; Antisense; AGTACGTGTACAACATCTCGCCCGA
>probe:Drosophila_2:1627006_at:162:639; Interrogation_Position=454; Antisense; TCTCGCCCGAGGTGCACAAAAACTA
>probe:Drosophila_2:1627006_at:95:625; Interrogation_Position=512; Antisense; TGCGCTGTAAATTCAATGTCCACGT
>probe:Drosophila_2:1627006_at:302:397; Interrogation_Position=530; Antisense; TCCACGTTCAACTCTAATCCATAAT
>probe:Drosophila_2:1627006_at:358:185; Interrogation_Position=625; Antisense; AAAATTCGTTGTTGTTCCATGTAGA
>probe:Drosophila_2:1627006_at:727:325; Interrogation_Position=655; Antisense; GCGAGCATATTAGTTTGCCTCCCAC
>probe:Drosophila_2:1627006_at:82:311; Interrogation_Position=676; Antisense; CCACTCGCGCGGGATTGTATTATCA
>probe:Drosophila_2:1627006_at:662:471; Interrogation_Position=710; Antisense; GTTCTGCCCAATACACGTTGTTGTT

Paste this into a BLAST search page for me
GACGCAGGGAATCCAGCAGTTGCTCAGCAGTTGCTCGCTGCCGAGAAAAAAGGTCGCCGAGGCTCGTAAACGCAAGCGAGCGCGCCTTCAAGGAGTTCGAGGATATCCGCGTTAAGCTGGCCGACGCAAGGACCCGTTCATCCTGGAGATAGTACGTGTACAACATCTCGCCCGATCTCGCCCGAGGTGCACAAAAACTATGCGCTGTAAATTCAATGTCCACGTTCCACGTTCAACTCTAATCCATAATAAAATTCGTTGTTGTTCCATGTAGAGCGAGCATATTAGTTTGCCTCCCACCCACTCGCGCGGGATTGTATTATCAGTTCTGCCCAATACACGTTGTTGTT

Full Affymetrix probeset data:

Annotations for 1627006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720