FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1627007_at:

>probe:Drosophila_2:1627007_at:459:311; Interrogation_Position=1014; Antisense; CCAATAAATGTCTTCTTGTGCCGCA
>probe:Drosophila_2:1627007_at:385:55; Interrogation_Position=478; Antisense; ATGAGCCTCGCACCGTTTACGTAAA
>probe:Drosophila_2:1627007_at:271:565; Interrogation_Position=512; Antisense; GGAATCTGAATCAACTCCTGCCCGA
>probe:Drosophila_2:1627007_at:628:625; Interrogation_Position=530; Antisense; TGCCCGAGCTTATCTACTGACCAAG
>probe:Drosophila_2:1627007_at:63:611; Interrogation_Position=547; Antisense; TGACCAAGCAGCCAGAGAGCAATCT
>probe:Drosophila_2:1627007_at:309:421; Interrogation_Position=563; Antisense; GAGCAATCTGTACGAACTGCCTAAG
>probe:Drosophila_2:1627007_at:298:657; Interrogation_Position=584; Antisense; TAAGGACTCCATTCCCTTATCCAGA
>probe:Drosophila_2:1627007_at:169:49; Interrogation_Position=602; Antisense; ATCCAGACAGCCCTCGAAAACATAT
>probe:Drosophila_2:1627007_at:480:361; Interrogation_Position=629; Antisense; GCAATGTCTCGTTAAAGGCGCTATT
>probe:Drosophila_2:1627007_at:148:227; Interrogation_Position=643; Antisense; AAGGCGCTATTGAGAGCTCCGTTCC
>probe:Drosophila_2:1627007_at:192:471; Interrogation_Position=663; Antisense; GTTCCGGAGGATTATGTTCAGCGAT
>probe:Drosophila_2:1627007_at:660:557; Interrogation_Position=708; Antisense; GGACAAGTTAACTCCTATCTGGAAC
>probe:Drosophila_2:1627007_at:72:499; Interrogation_Position=888; Antisense; GTCTTTATTGTTACACTGCAGCCAT
>probe:Drosophila_2:1627007_at:203:507; Interrogation_Position=955; Antisense; GTGCCATGTAATATTGCTACGCGAA

Paste this into a BLAST search page for me
CCAATAAATGTCTTCTTGTGCCGCAATGAGCCTCGCACCGTTTACGTAAAGGAATCTGAATCAACTCCTGCCCGATGCCCGAGCTTATCTACTGACCAAGTGACCAAGCAGCCAGAGAGCAATCTGAGCAATCTGTACGAACTGCCTAAGTAAGGACTCCATTCCCTTATCCAGAATCCAGACAGCCCTCGAAAACATATGCAATGTCTCGTTAAAGGCGCTATTAAGGCGCTATTGAGAGCTCCGTTCCGTTCCGGAGGATTATGTTCAGCGATGGACAAGTTAACTCCTATCTGGAACGTCTTTATTGTTACACTGCAGCCATGTGCCATGTAATATTGCTACGCGAA

Full Affymetrix probeset data:

Annotations for 1627007_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720